ID: 1037803870

View in Genome Browser
Species Human (GRCh38)
Location 8:22049049-22049071
Sequence AGAAAACCCGAGCCCCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037803866_1037803870 -4 Left 1037803866 8:22049030-22049052 CCGTGCTACCTGTTGGGGAAGAA 0: 1
1: 0
2: 0
3: 19
4: 174
Right 1037803870 8:22049049-22049071 AGAAAACCCGAGCCCCCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1037803865_1037803870 -3 Left 1037803865 8:22049029-22049051 CCCGTGCTACCTGTTGGGGAAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1037803870 8:22049049-22049071 AGAAAACCCGAGCCCCCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1037803861_1037803870 17 Left 1037803861 8:22049009-22049031 CCTGGGCTCGCGCGGCGCGGCCC 0: 1
1: 0
2: 5
3: 43
4: 308
Right 1037803870 8:22049049-22049071 AGAAAACCCGAGCCCCCGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037803870 Original CRISPR AGAAAACCCGAGCCCCCGGA GGG Intronic