ID: 1037803907

View in Genome Browser
Species Human (GRCh38)
Location 8:22049123-22049145
Sequence CCTCGCCTGCGCCTCGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 212}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037803907_1037803922 14 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803922 8:22049160-22049182 GGCGGAGCCCGGGCGGCCCGCGG 0: 1
1: 0
2: 2
3: 54
4: 496
1037803907_1037803925 22 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803925 8:22049168-22049190 CCGGGCGGCCCGCGGACGCCAGG 0: 1
1: 0
2: 2
3: 30
4: 212
1037803907_1037803919 7 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803919 8:22049153-22049175 GGAGCCCGGCGGAGCCCGGGCGG 0: 1
1: 0
2: 3
3: 45
4: 392
1037803907_1037803918 4 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803918 8:22049150-22049172 TGCGGAGCCCGGCGGAGCCCGGG 0: 1
1: 0
2: 5
3: 30
4: 255
1037803907_1037803913 -7 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803913 8:22049139-22049161 GGCGAGGGCCCTGCGGAGCCCGG 0: 1
1: 0
2: 6
3: 69
4: 539
1037803907_1037803917 3 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803917 8:22049149-22049171 CTGCGGAGCCCGGCGGAGCCCGG 0: 1
1: 0
2: 6
3: 33
4: 272
1037803907_1037803914 -4 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803914 8:22049142-22049164 GAGGGCCCTGCGGAGCCCGGCGG 0: 1
1: 0
2: 3
3: 33
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037803907 Original CRISPR CCTCGCCTGCGCCTCGGGCC TGG (reversed) Intronic