ID: 1037803907

View in Genome Browser
Species Human (GRCh38)
Location 8:22049123-22049145
Sequence CCTCGCCTGCGCCTCGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 212}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037803907_1037803925 22 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803925 8:22049168-22049190 CCGGGCGGCCCGCGGACGCCAGG 0: 1
1: 0
2: 2
3: 30
4: 212
1037803907_1037803918 4 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803918 8:22049150-22049172 TGCGGAGCCCGGCGGAGCCCGGG 0: 1
1: 0
2: 5
3: 30
4: 255
1037803907_1037803922 14 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803922 8:22049160-22049182 GGCGGAGCCCGGGCGGCCCGCGG 0: 1
1: 0
2: 2
3: 54
4: 496
1037803907_1037803914 -4 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803914 8:22049142-22049164 GAGGGCCCTGCGGAGCCCGGCGG 0: 1
1: 0
2: 3
3: 33
4: 373
1037803907_1037803913 -7 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803913 8:22049139-22049161 GGCGAGGGCCCTGCGGAGCCCGG 0: 1
1: 0
2: 6
3: 69
4: 539
1037803907_1037803917 3 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803917 8:22049149-22049171 CTGCGGAGCCCGGCGGAGCCCGG 0: 1
1: 0
2: 6
3: 33
4: 272
1037803907_1037803919 7 Left 1037803907 8:22049123-22049145 CCAGGCCCGAGGCGCAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1037803919 8:22049153-22049175 GGAGCCCGGCGGAGCCCGGGCGG 0: 1
1: 0
2: 3
3: 45
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037803907 Original CRISPR CCTCGCCTGCGCCTCGGGCC TGG (reversed) Intronic
900157449 1:1208913-1208935 CCTCGCCTGCCCCACGGGGCGGG + Intergenic
900606607 1:3526367-3526389 CCACGCCTGCTACTCAGGCCAGG + Intronic
900649487 1:3723941-3723963 CCTCTCCTGGGCCCCTGGCCTGG - Intronic
901019757 1:6249699-6249721 CCGCGCCGCCGCCCCGGGCCCGG - Exonic
901398986 1:9003218-9003240 CCTCCCCAGAGCCTGGGGCCGGG + Intergenic
902451501 1:16499352-16499374 CCCCGCCCCCGCCTCGGCCCCGG - Intergenic
903468368 1:23568131-23568153 CCCCGCCCGCGCCCCGCGCCCGG + Intergenic
904190236 1:28737468-28737490 TCTCCCCTGCCCCACGGGCCTGG + Intronic
904267273 1:29325218-29325240 CTGCGCCTGCGCCACGGTCCTGG + Exonic
904822939 1:33256798-33256820 GGCCGCCTGCGCCTCGGGCCCGG + Intronic
904832605 1:33314694-33314716 CCTCGCCTGCTCCTCCGTCACGG + Intronic
905473025 1:38207318-38207340 CCTCCCCTGGGCCTCTGGCAGGG + Intergenic
905886906 1:41496541-41496563 CCTCGCCTTCCCCTGGGGCCCGG + Intergenic
905960053 1:42035801-42035823 CCTTACCTGCGCGCCGGGCCGGG + Intronic
906317843 1:44799862-44799884 CCTCGCCCTCGCCCGGGGCCCGG - Intergenic
906532812 1:46533186-46533208 CATCTCCAGCGCCACGGGCCCGG + Intergenic
912460388 1:109827025-109827047 CCACGGCTGTGCCTGGGGCCCGG - Intergenic
913274172 1:117121709-117121731 CCTCTCCCGCGCCTCGGCCCGGG + Exonic
914386165 1:147172233-147172255 CCGCCCCTGCGCCTCGGGACAGG + Intronic
916666947 1:166975402-166975424 CCCCGCCTGCGCGGCCGGCCCGG - Intronic
916773446 1:167936197-167936219 CCCCGCCCGCGCCTCGGGGCGGG - Intronic
918040745 1:180912748-180912770 CCTCTCCTGAGCCGCGGCCCAGG - Intergenic
920401621 1:205680050-205680072 CCTCCCCGGAGCCCCGGGCCGGG - Intronic
923490262 1:234478341-234478363 CCTCGCGCGCGCCGCGGGCGCGG + Exonic
924383391 1:243483129-243483151 CCTCACCGTCGCCACGGGCCTGG - Intronic
924624661 1:245688457-245688479 GCGCGCCTCCGCCTCGGGCCCGG - Exonic
1065025354 10:21535032-21535054 CGCCGCCTGCGCCTGGGGCCGGG + Intronic
1066220547 10:33334231-33334253 CCCCGCCTGAGCCCCGGTCCGGG + Intronic
1069993411 10:72328676-72328698 CCTCGCCTACTCCTCTGCCCAGG - Intergenic
1070156656 10:73839670-73839692 CCTGGGCTGCGCCTCGCGCTGGG - Intronic
1070162597 10:73874741-73874763 CCTCGGCTGCCCCGCGCGCCTGG - Intergenic
1071527387 10:86366419-86366441 CCTCGGCCTCGCCCCGGGCCCGG - Exonic
1071690785 10:87817949-87817971 CCTCGCCTTGGCGTCCGGCCCGG - Exonic
1073460229 10:103661704-103661726 CCTCGCCTGGGCCTGGGCCGTGG - Intronic
1078225153 11:9384918-9384940 CGTCGTCCGCGCCTCCGGCCAGG - Intronic
1079007106 11:16799835-16799857 CCTCGCCTGTGGCTCAGGGCTGG - Intronic
1079126171 11:17719992-17720014 CCTCACGTGCGCCCGGGGCCGGG - Exonic
1080418476 11:32091007-32091029 GCGCGCCTGGGCCTCGGGCTGGG - Exonic
1084086148 11:66856348-66856370 CCCCGCCCGCCCCGCGGGCCAGG - Intronic
1084151391 11:67289413-67289435 CCCCGCCTCGGCTTCGGGCCTGG - Exonic
1084483368 11:69434597-69434619 CCTCCCCAGGGCCTGGGGCCTGG - Intergenic
1085413694 11:76306648-76306670 CCTGGCCTGGCCCTGGGGCCTGG + Intergenic
1085764270 11:79269633-79269655 CCTCGCCTGCCCCGATGGCCAGG + Intronic
1088480880 11:110296073-110296095 CCTGGACTGGGCCCCGGGCCCGG - Intronic
1097035517 12:56121175-56121197 CCTCGCCGGCGTTTTGGGCCTGG - Exonic
1097246780 12:57611490-57611512 CCTCGCCTCCTCCCCGGCCCGGG + Intronic
1100186460 12:92145288-92145310 CCTCGGCAGCGCCCCGGGGCCGG - Intronic
1102678515 12:114674413-114674435 CCTCGGCTTCGCCCCGGGCCTGG - Exonic
1103321397 12:120094670-120094692 CCTCCCCTGCCCCTCCCGCCTGG + Intergenic
1103601761 12:122058941-122058963 CCACGCTTGGGCCTCGGGTCTGG + Intronic
1104686532 12:130788550-130788572 CCTCAGCTGCGCCGAGGGCCTGG + Intergenic
1105243686 13:18628927-18628949 CCTCCCCTGCACCTAGGGTCCGG - Intergenic
1106735940 13:32587197-32587219 CCTGGCCTCCGCTTCGGGCCAGG + Intronic
1107276647 13:38687153-38687175 CCTCGGCTGCGGCTCCAGCCCGG + Exonic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1111937337 13:94570665-94570687 CCTCAGCTGGGCCTCTGGCCTGG + Intergenic
1112507145 13:99981953-99981975 CGCCGCCTGCGCCTGGAGCCCGG + Exonic
1113654327 13:112058443-112058465 CCTCCCCTGCACCTAGGGCCTGG + Intergenic
1116835736 14:49767976-49767998 CCGCGCCTCCGCCTACGGCCTGG - Exonic
1118736442 14:68704752-68704774 CCTCACCCGAGCCTCAGGCCTGG + Intronic
1118752347 14:68816424-68816446 CCTCGCCCGGGCCCCGCGCCCGG - Intergenic
1118896999 14:69953565-69953587 CCTCCCCTCTGCCTCGGTCCAGG - Intronic
1122073606 14:99221572-99221594 CCTGGCCTGCCCCTCCCGCCTGG - Intronic
1122619304 14:103045461-103045483 CAGCGCCTGCTCCTCGGGGCTGG - Intronic
1122626764 14:103089050-103089072 CCTCTCCTGTTCCTTGGGCCTGG - Intergenic
1123443204 15:20304640-20304662 CCTGGCCTGGACCTCGGTCCTGG + Intergenic
1124696675 15:31870045-31870067 CCTCGCGCGCGGCTCGGGGCCGG + Intronic
1126982094 15:54255735-54255757 CCACGCCTGGGCCTCTGCCCAGG - Intronic
1127084067 15:55408386-55408408 TCCCGCCTGCGCCTCCTGCCCGG + Intronic
1127261052 15:57326487-57326509 CCTGGCCTCCACCTCGGTCCCGG + Intergenic
1128480812 15:68036410-68036432 CCTTGCTTGTGCCTCGGACCTGG - Intergenic
1129677088 15:77637462-77637484 CCTCACCTTCCCCTCGGGCGGGG + Intronic
1133058484 16:3159170-3159192 ACTCGCCTGCGCCTCCTGACTGG + Intergenic
1133556157 16:6908266-6908288 CCTCTCCTGCGGCTCTGGGCAGG + Intronic
1133784329 16:8963303-8963325 CCTCGCCTGCGGCCGGGGGCCGG + Exonic
1134717139 16:16362868-16362890 CCTCGGCTGAGGCTGGGGCCGGG - Intergenic
1134957613 16:18389291-18389313 CCTCGGCTGAGGCTGGGGCCGGG + Intergenic
1135664839 16:24326956-24326978 TCTGGCCTGAGCCTCGAGCCTGG - Intronic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1138360639 16:56425037-56425059 CCGCCCCTGCCCCGCGGGCCCGG + Intronic
1139403039 16:66696937-66696959 CCCCACCTGCGCCTAGAGCCGGG + Intergenic
1139583470 16:67886398-67886420 CCTTGCTTGCGGCTGGGGCCAGG + Intronic
1139948438 16:70657325-70657347 CATCGCCTGCACCCCGAGCCCGG - Intronic
1141609175 16:85171410-85171432 ACCCGCCTGCCCCTCGTGCCAGG + Exonic
1142287549 16:89177554-89177576 CGTCCCCTGTGCCCCGGGCCTGG - Intronic
1142611038 17:1109312-1109334 GTTCGCCTCCGCCACGGGCCGGG - Intronic
1142852584 17:2711455-2711477 CCTTCCCTCCGCGTCGGGCCCGG - Intronic
1143474720 17:7196083-7196105 CCCTGGCTGCGCCTCAGGCCTGG + Intronic
1148542661 17:48492738-48492760 CCTCGCCAGCGCTGCCGGCCCGG - Intergenic
1148551264 17:48551935-48551957 CCTCGCGGGCGCCTAGGGGCTGG + Intronic
1149451689 17:56754666-56754688 CCTCTCCTGCCACTCAGGCCGGG + Intergenic
1150265898 17:63832275-63832297 CCTCTCCAGCGGCTTGGGCCGGG - Exonic
1150823833 17:68457482-68457504 CCGCGCCGGCTCCACGGGCCGGG + Intronic
1152217690 17:79044013-79044035 CCTTGCCTTTGCCTCTGGCCTGG + Exonic
1152489615 17:80621488-80621510 CCTCCTCTGCGTCTCGGGGCTGG - Intronic
1152570863 17:81120707-81120729 CAGCACCTGCCCCTCGGGCCTGG - Exonic
1152587381 17:81195127-81195149 CCTCCCCAGCGCCCGGGGCCAGG + Intronic
1152718520 17:81911291-81911313 GCGCGCCTGCCCCCCGGGCCCGG + Exonic
1154445256 18:14430958-14430980 CCTCCCCTGCACCTAGGGTCCGG + Intergenic
1155053229 18:22165713-22165735 CCTGGCCTGCGCAACGCGCCGGG + Intergenic
1157818494 18:50748512-50748534 CCTCTCCTGGGGCTCAGGCCAGG + Intergenic
1160738153 19:674167-674189 CCTAGGATGAGCCTCGGGCCTGG + Intergenic
1160801989 19:974478-974500 CCACGCCTGGGCCCCGCGCCGGG + Exonic
1161960497 19:7520488-7520510 GCCGGCCTGGGCCTCGGGCCTGG + Exonic
1162410343 19:10502091-10502113 CCTCTCCTGTGCCTCTCGCCTGG + Intronic
1162457898 19:10796836-10796858 CCGCGCCAACGCCGCGGGCCTGG + Intronic
1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG + Intronic
1163035854 19:14568411-14568433 CCTCGCTTGAGCCCCAGGCCTGG + Intronic
1165058572 19:33194290-33194312 CCTCGCCCGCGCCCGGAGCCTGG - Intronic
1166351881 19:42202854-42202876 CCTCGCCTGCTCCTATTGCCTGG - Intronic
1167076645 19:47254218-47254240 CCTCTCCTGCCCCTCTTGCCAGG + Intergenic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167738752 19:51311852-51311874 CCCCCCCTGCGCCCGGGGCCCGG + Exonic
1168151134 19:54449457-54449479 CTGCGCCTGCGCACCGGGCCTGG + Intronic
1168288526 19:55346166-55346188 CCTCCCCTGTGCCCTGGGCCAGG + Intronic
1168337643 19:55605552-55605574 CCACGCCGGCGCCTCGGGAACGG + Intronic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
927159224 2:20242391-20242413 CCTCCCCTGCGCCGCGGGTCCGG - Intergenic
927606567 2:24491506-24491528 CCTCCGCCGCTCCTCGGGCCCGG - Intergenic
927881491 2:26692818-26692840 CCCGGCCCGCGCCTCGGCCCCGG - Exonic
929000717 2:37344835-37344857 CCTCACCTTCTCCTCTGGCCAGG - Exonic
929570614 2:43020651-43020673 CCTTGCCTGCCCCTGTGGCCAGG - Intergenic
931321596 2:61178164-61178186 TCTGCCCTGCGCCTCTGGCCGGG + Exonic
934717687 2:96552926-96552948 CCTCCCCTGCCCCTCCTGCCAGG - Intergenic
934761150 2:96857827-96857849 CCACGCCTCCTCCTTGGGCCGGG + Intronic
936021807 2:109000939-109000961 CCTCACCTGGGCCTCAGGGCAGG - Intergenic
942241355 2:173965608-173965630 GGAGGCCTGCGCCTCGGGCCTGG - Exonic
944128632 2:196321231-196321253 CCTTGCCTGGGCCCCGGGCTTGG + Intronic
947796118 2:232895029-232895051 AATCGCCTGCTCCTGGGGCCTGG + Intronic
948280861 2:236747118-236747140 CCTCGCCTGCCCCACAGCCCCGG - Intergenic
948684141 2:239659500-239659522 ACTTGCCTGCACCTCAGGCCTGG + Intergenic
1171452840 20:25248027-25248049 CCGCGCCTGCGCGCCGCGCCGGG - Intergenic
1172978966 20:38926847-38926869 CTTCGCCAGCGCCGCGGGGCTGG - Exonic
1173166090 20:40688266-40688288 CGTCGCGTGCGGCCCGGGCCCGG + Exonic
1174091519 20:48052395-48052417 CCCCACCTGCACCTCAGGCCAGG + Intergenic
1174246720 20:49187785-49187807 CCCCGCCTGCGCCCCAGCCCCGG + Intronic
1175900877 20:62359465-62359487 CCTTCCCTGGGCCTGGGGCCTGG + Intronic
1176218007 20:63957316-63957338 CCCCGACTGGGCCTCGGGCAGGG + Exonic
1176274409 20:64255676-64255698 CTGCGCATGCGCCGCGGGCCTGG - Intronic
1176373981 21:6078162-6078184 CCTGGCCCCTGCCTCGGGCCAGG + Intergenic
1178684708 21:34702079-34702101 GCTCCCATGCGCCTGGGGCCGGG - Intronic
1179749496 21:43460081-43460103 CCTGGCCCCTGCCTCGGGCCAGG - Intergenic
1179803976 21:43825821-43825843 CCTTGGCTGCCCCTCGGGCCTGG + Intergenic
1181036852 22:20173932-20173954 CCTGGCCTGTCCCTTGGGCCAGG - Intergenic
1183684124 22:39351612-39351634 CCACCCCTGGGCCTCTGGCCTGG + Intronic
1184169939 22:42752758-42752780 CCTCGTCTGCCTCTCGGGACAGG - Intergenic
1185150049 22:49159176-49159198 CCCCGTCTGGGCCCCGGGCCGGG - Intergenic
1185292233 22:50032878-50032900 CCTCCCCTGCGCCAGGGCCCAGG + Intronic
1185342349 22:50297274-50297296 CCCCGCCCACGCCTGGGGCCTGG - Intronic
1185368056 22:50445968-50445990 CCTCACCAGCCCCTCTGGCCAGG + Exonic
953150451 3:40319747-40319769 CCTTGCATGCTCCTGGGGCCAGG - Intergenic
953577044 3:44121154-44121176 CCTTCCCTGAGCCCCGGGCCAGG + Intergenic
954109569 3:48426573-48426595 CCTCCCCTGAGCCTTGTGCCCGG - Intronic
954663694 3:52239225-52239247 CGCAGCCTGCGCCTCGGTCCGGG + Exonic
954848364 3:53579026-53579048 CTCCGCCTGCTGCTCGGGCCTGG - Intronic
962498459 3:135965900-135965922 CCTCGCCACCCCCTCGGGCCGGG - Intronic
964273959 3:154988175-154988197 CATGGGCTGCTCCTCGGGCCTGG - Intergenic
967018060 3:185498975-185498997 TCTCGGCTGCCCCGCGGGCCGGG - Exonic
968517985 4:1022861-1022883 TCTCTTCTGCGCCTGGGGCCCGG + Intronic
968649729 4:1755750-1755772 CCTCCCCTGCCCCCGGGGCCTGG - Intergenic
968912621 4:3483850-3483872 CCTTGCCTGCCCCCAGGGCCTGG + Intronic
969600607 4:8173942-8173964 CCACACCTGCCCCTCGGGGCTGG + Intergenic
969666188 4:8558672-8558694 CCTCCCCTGCGGCTCGGTGCTGG - Intergenic
969680387 4:8640022-8640044 CCTCTCCAGCGTCTCGGGCAGGG + Intergenic
969703308 4:8779437-8779459 CTTCTCCTGCACCTCGGGCCAGG + Intergenic
969872990 4:10116392-10116414 CCTGGTCCGCGCCCCGGGCCAGG + Intronic
973292451 4:48483697-48483719 CCTGGGCTCAGCCTCGGGCCGGG + Exonic
978126994 4:105146726-105146748 CCTCGCGAGCGCCGCGCGCCCGG + Exonic
979311953 4:119213110-119213132 CCTCGCGAGCGCCTCCAGCCTGG - Intronic
982668049 4:158291070-158291092 CCTGCCCTGTGCCTTGGGCCTGG - Intergenic
983283032 4:165705239-165705261 CCTCCCCTGGGCCTCCTGCCGGG + Intergenic
984639406 4:182144979-182145001 CTTCGCCGGCGCCTCTCGCCCGG + Intronic
985783608 5:1883052-1883074 ACTCGCCGGCGGCTCAGGCCGGG + Intronic
989106528 5:37868078-37868100 GCTTGCCTGCTCCTCGGGCTTGG + Intergenic
996862495 5:128083040-128083062 GCTGGCCTGCGGCTCCGGCCCGG + Intergenic
1001150763 5:169225625-169225647 CCTTCCCTGCCCCTCGGGCGTGG - Intronic
1001588046 5:172846420-172846442 CCTGGCCTGCCCCTTGTGCCAGG + Intronic
1003427349 6:6006622-6006644 CCCCCTCCGCGCCTCGGGCCGGG + Intronic
1004627926 6:17393938-17393960 CCGCGCCCGCGCCCCGCGCCCGG - Intronic
1005859186 6:29888234-29888256 CGTGACCTGCGCCCCGGGCCGGG - Intergenic
1005866752 6:29943036-29943058 CCTGACCTGCGCCCCCGGCCGGG - Intronic
1005905653 6:30260094-30260116 CGTGACCTGCGCCCCGGGCCAGG - Intergenic
1006043190 6:31271567-31271589 CGTGACCTGCGCCCCGGGCCGGG + Intronic
1006052778 6:31356656-31356678 CGTGACCTGCGCCCCGGGCCGGG + Intronic
1006300730 6:33192500-33192522 CCTCGCCCCCGCCCCCGGCCCGG + Intergenic
1007699776 6:43759754-43759776 CCTCCCCAGTGCCTGGGGCCAGG + Intergenic
1007702006 6:43771120-43771142 CCTGGCCCGGGCCTCGGGCCGGG + Exonic
1014688143 6:124529633-124529655 CTTCTCCTAAGCCTCGGGCCAGG - Intronic
1015965698 6:138693438-138693460 CCTCGCCCGCCCCCCGGGCCGGG + Intergenic
1016010655 6:139135150-139135172 CCGCGCGGGCGCCGCGGGCCCGG - Exonic
1016596991 6:145814492-145814514 CAGCGCCAGCGCCTCGGTCCCGG + Intronic
1018866191 6:167748517-167748539 CCCAGCCTGAGCCTGGGGCCGGG + Intergenic
1018945632 6:168345678-168345700 CCTCGGCTGCCCCGCCGGCCGGG - Intergenic
1018975874 6:168565311-168565333 CCCTGCCAGCACCTCGGGCCTGG - Intronic
1019352361 7:560562-560584 CCTGTCCTGCACCTTGGGCCAGG + Intronic
1019649595 7:2149551-2149573 CCTCCCCTGTGCCAGGGGCCTGG - Intronic
1023850309 7:44146354-44146376 CCATCCCTGCGCCCCGGGCCTGG + Intronic
1023866695 7:44241813-44241835 TCTCCCCTGTGCCTCGGGCTCGG - Intronic
1024262416 7:47582203-47582225 CCGCGCCCGCGCCCCGAGCCTGG + Intronic
1034274382 7:149817678-149817700 CCTGGTCAGCCCCTCGGGCCTGG + Intergenic
1035112466 7:156494754-156494776 CCTCGCATGGGCCCTGGGCCTGG - Intergenic
1035233779 7:157483762-157483784 CCTCACCTGCACACCGGGCCGGG - Intergenic
1035233799 7:157483818-157483840 CCTCGCCTGCACGCAGGGCCGGG - Intergenic
1035464453 7:159065406-159065428 CCTTCCCTGCCCCTCTGGCCAGG + Intronic
1036203196 8:6786292-6786314 CCTTGCCAGCCCCTCTGGCCTGG - Intergenic
1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG + Intronic
1037769162 8:21788983-21789005 CCTCTCCTCCGCCCCGGGCTCGG + Intronic
1037803907 8:22049123-22049145 CCTCGCCTGCGCCTCGGGCCTGG - Intronic
1037947728 8:22999709-22999731 CAGCGCCTTCGCCGCGGGCCCGG + Intronic
1038038016 8:23702680-23702702 CCCTGCCTGGGCCCCGGGCCCGG - Exonic
1038580418 8:28743811-28743833 CATCGCCTGTGCCTCTGGCTTGG - Intronic
1042164321 8:65930810-65930832 CCTGGCCTGGGCCTCGTCCCTGG + Intergenic
1043463720 8:80486061-80486083 GCTGGGCTGCGCCTCCGGCCTGG - Intronic
1043472672 8:80578274-80578296 CCGCGCCTCCTCCTAGGGCCCGG + Intergenic
1044591194 8:93916430-93916452 CCTCCCCTGCGCCTCGCGGTTGG - Intronic
1047423758 8:124727802-124727824 CTTCGCCTCCACCCCGGGCCGGG - Intronic
1049715252 8:144086735-144086757 CCCCGCCTGCCCCTGGGTCCTGG - Intergenic
1049768047 8:144364329-144364351 CCTCACTTGAGCCTCAGGCCTGG - Intergenic
1059832205 9:118109771-118109793 CCTCACCTGAGCCTTGGGCCTGG + Intergenic
1060406085 9:123373762-123373784 CTTTGCCTGCGCCTGCGGCCCGG + Exonic
1060700824 9:125747697-125747719 CCTCGACTCGGCCGCGGGCCCGG - Intronic
1061519914 9:131111879-131111901 CCTCGCCTGCAGCCCGGTCCTGG + Intronic
1061610112 9:131740234-131740256 CCACGCCGGGGCCTGGGGCCTGG + Intergenic
1062542133 9:137046176-137046198 CCTCGCCGGCGCCTCCATCCCGG - Exonic
1062594983 9:137295503-137295525 CCCGCACTGCGCCTCGGGCCCGG - Intergenic
1062630822 9:137462386-137462408 CCTGTCCTGCGCCACGGGCCAGG - Intronic
1186496505 X:10015720-10015742 CCGCGCCGCCGCCGCGGGCCCGG + Exonic
1189308600 X:40005390-40005412 GCTCGCCCGCGCCCCGGGCTCGG - Intergenic
1190213553 X:48466364-48466386 TCTGGCCTGCACCTCTGGCCTGG - Intronic
1190327956 X:49218396-49218418 CCTGCCCTGCCCCTGGGGCCAGG - Intronic
1197734893 X:129843406-129843428 CCGCGCCCGCGGCTCGGCCCCGG - Intronic
1200243259 X:154508584-154508606 CCTGCCCAGCGCCACGGGCCAGG - Exonic
1200267912 X:154655681-154655703 CCTCCCCTACACCTGGGGCCTGG - Intergenic