ID: 1037804444

View in Genome Browser
Species Human (GRCh38)
Location 8:22051169-22051191
Sequence ATTTAGGGGAGGATGTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037804434_1037804444 5 Left 1037804434 8:22051141-22051163 CCCCTTGCCGTTGGGGAAACACG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1037804444 8:22051169-22051191 ATTTAGGGGAGGATGTGACCAGG No data
1037804437_1037804444 -2 Left 1037804437 8:22051148-22051170 CCGTTGGGGAAACACGAACCCAT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1037804444 8:22051169-22051191 ATTTAGGGGAGGATGTGACCAGG No data
1037804436_1037804444 3 Left 1037804436 8:22051143-22051165 CCTTGCCGTTGGGGAAACACGAA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1037804444 8:22051169-22051191 ATTTAGGGGAGGATGTGACCAGG No data
1037804430_1037804444 29 Left 1037804430 8:22051117-22051139 CCACAGGGGGCTAATTGCTAATA 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1037804444 8:22051169-22051191 ATTTAGGGGAGGATGTGACCAGG No data
1037804435_1037804444 4 Left 1037804435 8:22051142-22051164 CCCTTGCCGTTGGGGAAACACGA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1037804444 8:22051169-22051191 ATTTAGGGGAGGATGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037804444 Original CRISPR ATTTAGGGGAGGATGTGACC AGG Intronic
No off target data available for this crispr