ID: 1037808038

View in Genome Browser
Species Human (GRCh38)
Location 8:22069302-22069324
Sequence TTGGAGGGATGCAGCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037808028_1037808038 9 Left 1037808028 8:22069270-22069292 CCTTGGAACTGTGCCACAACATT 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1037808038 8:22069302-22069324 TTGGAGGGATGCAGCCGGCCAGG 0: 1
1: 0
2: 4
3: 12
4: 138
1037808027_1037808038 21 Left 1037808027 8:22069258-22069280 CCATCAGTAGGTCCTTGGAACTG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1037808038 8:22069302-22069324 TTGGAGGGATGCAGCCGGCCAGG 0: 1
1: 0
2: 4
3: 12
4: 138
1037808025_1037808038 28 Left 1037808025 8:22069251-22069273 CCAGGCACCATCAGTAGGTCCTT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1037808038 8:22069302-22069324 TTGGAGGGATGCAGCCGGCCAGG 0: 1
1: 0
2: 4
3: 12
4: 138
1037808031_1037808038 -4 Left 1037808031 8:22069283-22069305 CCACAACATTGCCCTGGGTTTGG 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1037808038 8:22069302-22069324 TTGGAGGGATGCAGCCGGCCAGG 0: 1
1: 0
2: 4
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037808038 Original CRISPR TTGGAGGGATGCAGCCGGCC AGG Intronic
900184426 1:1326290-1326312 GTGGGGGGATGCTGCCGGGCAGG - Intronic
900352474 1:2242062-2242084 TTGTTGGGAGGCAGCAGGCCAGG + Intronic
900477142 1:2881391-2881413 TTTGGGGGCTGCAGCCGGCGGGG + Intergenic
900985723 1:6071948-6071970 CTGCAGGGTTGCAGCAGGCCAGG - Intronic
901075839 1:6554298-6554320 CTGGAGGGAGGGAGCCCGCCAGG - Exonic
901441849 1:9282781-9282803 TTGGAGGGATGGAGCCATTCAGG + Intergenic
902620613 1:17648627-17648649 AGGCAGGGATGCAGCAGGCCAGG - Exonic
904940937 1:34164654-34164676 TTGGACGGATGCGGCCGGTGTGG - Intronic
906288489 1:44603783-44603805 TGTGAGGGAGGCAGCTGGCCTGG + Intronic
916086646 1:161275080-161275102 TGGGAGGGAAGCAGCTGGCAGGG + Intronic
924042665 1:239998256-239998278 TTCGCGGGGTGCAGCCGCCCGGG + Intergenic
924065803 1:240220540-240220562 TTGGATGGCTGCAGCCTGGCAGG - Intronic
924415149 1:243850249-243850271 AGGGAGGGAGGGAGCCGGCCGGG + Intronic
1064727628 10:18297603-18297625 GTGGAGGAATTCAGTCGGCCTGG - Intronic
1067553732 10:47253523-47253545 TTGGAGGGATGAAGCAGGCCTGG + Intergenic
1067684033 10:48456714-48456736 GGGCAGGGATGCAGCCGGGCAGG - Intronic
1067957297 10:50806379-50806401 TGGGAGGGATGGAGCAGACCTGG - Exonic
1069933740 10:71900971-71900993 GTGGATGGGTGCAGCCGGCCTGG + Intergenic
1070269085 10:74934482-74934504 TTTAAAGGATGCAGCCGGCATGG - Intronic
1070300100 10:75197261-75197283 TTGGCGGGGAGCAGCCTGCCTGG + Intergenic
1073215233 10:101832608-101832630 TGGGAGGGAGGCAGTGGGCCAGG + Intronic
1073441491 10:103555298-103555320 GAGGAGGGGAGCAGCCGGCCGGG + Intronic
1074976617 10:118586841-118586863 GTGGAGGGATGGGGCCAGCCTGG - Intergenic
1074976626 10:118586865-118586887 ATGGAGGGATGGAGCCAGCCTGG - Intergenic
1074976651 10:118586937-118586959 GTGGAGGGATGGGGCCAGCCTGG - Intergenic
1074976662 10:118586961-118586983 GTGGAGGGATGGGGCCAGCCTGG - Intergenic
1074976673 10:118586985-118587007 GTGGAGGGATGGGGCCAGCCTGG - Intergenic
1075442784 10:122493178-122493200 TTGGAGGGAGACAGCAGGGCAGG - Intronic
1077106626 11:845075-845097 CAGGAGGGATGCAGCCCTCCGGG - Intronic
1078549770 11:12272072-12272094 ATGGAGGGATGGAACAGGCCAGG - Intergenic
1078635812 11:13048818-13048840 TTAAAATGATGCAGCCGGCCCGG - Intergenic
1083667673 11:64284658-64284680 CTGGAGGGAGGCGGCAGGCCCGG - Intronic
1083821015 11:65171412-65171434 CTGGGGGGCTGCAGCCGGCAAGG + Exonic
1084458872 11:69285259-69285281 TAGGAGGGATGCAGCGAGGCTGG - Intergenic
1084594406 11:70108476-70108498 TGGGAGGCAGGCAGCCGGCTTGG + Intronic
1084636089 11:70393766-70393788 TTGGAGGGATGCAGGCTGGTGGG + Intergenic
1084935459 11:72584362-72584384 TTGGAGGGAGGGATCCGGCCGGG + Intronic
1089469075 11:118706478-118706500 CTTGAGGGATACAGCCAGCCAGG + Intergenic
1090918439 11:131187183-131187205 TGGGAGGGATGCTGGCGGCGGGG + Intergenic
1091208133 11:133834556-133834578 CTGGAGGGCAGCAGCCGGACAGG - Intergenic
1092229836 12:6770249-6770271 TGTCAGGGATGCAGCCGGGCTGG + Intronic
1098983575 12:76985573-76985595 TTGGAGGCCAGCAGCCAGCCTGG + Intergenic
1103974339 12:124692476-124692498 TTGGAGGGATGCAGCCAACCTGG + Intergenic
1104766055 12:131331047-131331069 ATGGATGGATGCTGCTGGCCTGG - Intergenic
1110750842 13:79113870-79113892 TTGCAGGGATGAAGCCGACTTGG + Intergenic
1113088692 13:106594730-106594752 GTGGGGGTTTGCAGCCGGCCTGG + Intergenic
1113610239 13:111639510-111639532 TTGGTGGGATGCCACAGGCCTGG - Intronic
1115229987 14:31150101-31150123 TTGGAGTGATGCAGCAGCCTTGG - Exonic
1122961516 14:105096127-105096149 TTGGAGGGATGTATCAGCCCCGG - Intergenic
1124121172 15:26890512-26890534 TTGGAGACATGGAGCCTGCCTGG + Intronic
1130895147 15:88164224-88164246 GTGGTGGGCTGCAGCCGGGCTGG + Intronic
1132196452 15:99917757-99917779 TTGGAGGGAGGCATCTGGGCTGG - Intergenic
1132314564 15:100880261-100880283 TCGCAGGGATGCGGGCGGCCCGG - Intronic
1139749452 16:69100443-69100465 TTGGAGGGTTGGAGGCAGCCTGG + Intergenic
1140227965 16:73093926-73093948 TAGCAGGGATGTAGCCGGCATGG + Intergenic
1140281027 16:73555533-73555555 TTGAAAGGATGCAGTTGGCCGGG + Intergenic
1140698223 16:77556307-77556329 ATGCAGGGATGCACCAGGCCTGG + Intergenic
1142189243 16:88710092-88710114 CTGGCGGGCTGCAGCAGGCCAGG - Intronic
1143015384 17:3888769-3888791 TGCGAGGGAGGCGGCCGGCCGGG + Intronic
1143015624 17:3889837-3889859 TTTGAGGGATGCAGCTGGATGGG - Intronic
1143243584 17:5464797-5464819 TTGAAGGGAGGCAGCAGGCTGGG - Intronic
1143305695 17:5945009-5945031 TTGGAGGGATCCAGGATGCCTGG - Intronic
1146832436 17:36081632-36081654 TTGGAGGGTGGCAGCCTGCAAGG - Intergenic
1146846918 17:36187950-36187972 TTGGAGGGTGGCAGCCTGCAAGG - Intronic
1151322712 17:73361328-73361350 CTGGAAGGATGCAGCCTGGCAGG - Intronic
1151412388 17:73939916-73939938 TTGGAGGGTTGCAGCCTCCCAGG + Intergenic
1151909002 17:77069105-77069127 CTGTTGGGATGCAGCAGGCCGGG - Intergenic
1152179250 17:78807522-78807544 TTGGAGGAATGCAGCCGTTCTGG + Exonic
1152210432 17:79000410-79000432 GTGGAGGGAGGCAGCCGGCATGG - Intronic
1152705906 17:81843550-81843572 TGGGAGGGACGGAGCCGGACTGG - Exonic
1155411899 18:25555652-25555674 TTGGTGGGATGGAGCAGGCAAGG + Intergenic
1156610805 18:38721862-38721884 CTGGAGGGAGTCAGCCGGCCTGG - Intergenic
1160354672 18:78216755-78216777 GTGGAGGGAGGCTGCCTGCCTGG + Intergenic
1161087678 19:2342783-2342805 CTGAGGGGACGCAGCCGGCCAGG + Intronic
1161087699 19:2342847-2342869 CTGAGGGGACGCAGCCGGCCAGG + Intronic
1162394572 19:10409361-10409383 TTGGAGGGGTCCAGCCGGCCAGG - Intronic
1164435418 19:28224391-28224413 TTGGAGGGATGCAGAAGCCCTGG - Intergenic
1164478350 19:28592298-28592320 TTGGAAGGATGGAGCCTGGCAGG - Intergenic
925384742 2:3454274-3454296 CTGGAGGGGTGTAGCCTGCCTGG + Intronic
925384762 2:3454343-3454365 CTGGAGGGGTGTAGCCTGCCTGG + Intronic
925384782 2:3454412-3454434 CTGGAGGGGTGTAGCCTGCCTGG + Intronic
925384801 2:3454481-3454503 CTGGAGGGGTGTAGCCTGCCTGG + Intronic
927802026 2:26109762-26109784 TTTCAGGGATACAGCAGGCCAGG + Exonic
929681300 2:43995835-43995857 GAGGCGGCATGCAGCCGGCCCGG + Exonic
932180723 2:69643768-69643790 TTGGGTGGATGGAGCCGGGCGGG - Intronic
944538127 2:200731172-200731194 TGGCAGGGATGCAGCCTACCTGG - Intergenic
946054284 2:216887376-216887398 TTGGAGAGAAGCAGCAGGCATGG - Intergenic
946185271 2:217977371-217977393 TTGCAGAGATGCAGAGGGCCTGG - Intronic
948426439 2:237890009-237890031 AAGGAGGGACGCAGCCGGCGGGG - Intronic
948720558 2:239897637-239897659 TCAGAGGGAAGCTGCCGGCCTGG - Intronic
1172891764 20:38270975-38270997 TTGAAGGGAGTCAGCCGGCGGGG - Intronic
1173800188 20:45890495-45890517 CTGGTGGGCCGCAGCCGGCCAGG - Exonic
1173838210 20:46139341-46139363 TTGGAGGCAGCCAGCCGGCTGGG + Intergenic
1174059584 20:47823234-47823256 TTGGAGGGATTCTGCCAGCTTGG + Intergenic
1181672523 22:24432395-24432417 TTGACGGGATGGAGCAGGCCAGG + Intronic
1182516561 22:30862259-30862281 TTGGAGGGCAGCAGCAGGGCAGG + Intronic
1182897968 22:33874219-33874241 TTAGAGGGATACAGCAGGCCAGG + Intronic
1184250070 22:43254980-43255002 TGGGAGGGAAGCTACCGGCCAGG - Intronic
1185326176 22:50226905-50226927 CTGGAGGGCTGCTGCCGGCAGGG - Intronic
950345226 3:12287575-12287597 TTAGGGGGATGCCCCCGGCCAGG - Intronic
950564898 3:13763071-13763093 GTGGAGGGAAGCAGGCGACCGGG - Intergenic
954122499 3:48507717-48507739 ATGGAGGGCTGCAGCAGTCCTGG + Intergenic
954379552 3:50212401-50212423 TTGGAGGGATGCTGATGGCAAGG + Intronic
954558784 3:51538782-51538804 GAGGCGGGAAGCAGCCGGCCAGG - Intergenic
956435562 3:69231582-69231604 TTAGAAGGATGCAGCTGGGCCGG - Intronic
956971345 3:74530514-74530536 TTGGAGGGATGCAGTGGTCTGGG + Intergenic
959210581 3:103374826-103374848 TTGGCGGGCTGCAGTTGGCCGGG - Intergenic
961328345 3:126124693-126124715 TGGCAGGGCTCCAGCCGGCCAGG + Intronic
962289804 3:134124333-134124355 TTGGAGGCAAGCAGCTTGCCTGG - Intronic
966918131 3:184595970-184595992 GAGGAAGGATGCAGCCAGCCGGG + Intronic
968974015 4:3811731-3811753 CTGGGTGGATGCAGCCGCCCAGG + Intergenic
969074911 4:4570313-4570335 GTGGAGGGATGCAGGTGACCAGG + Intergenic
971764440 4:30811539-30811561 TTGGAGGGAAGCAACTGGGCAGG + Intronic
973656040 4:53048771-53048793 TTGGAGGAATGCAGGCAGCATGG - Intronic
973656223 4:53050816-53050838 TTGGAGGAATGCAGGCAGCATGG - Intronic
974259124 4:59502188-59502210 TTAGAGGCATGCAGGCTGCCAGG + Intergenic
980867093 4:138564576-138564598 TTGGAGGAATGCAGCAGTGCTGG + Intergenic
982573314 4:157076536-157076558 GTGGAGAGATGCAGAGGGCCGGG + Intronic
985629498 5:1007353-1007375 TAGCAGGGTTGCACCCGGCCAGG - Intergenic
985921518 5:2981109-2981131 TAGGAGTGAAGCAGCCGACCTGG - Intergenic
988489316 5:31693067-31693089 TTGGAAGGACGCAGCCTGGCAGG + Intronic
990515942 5:56530918-56530940 TTGGAGGGCAGCAGATGGCCAGG - Intronic
997266237 5:132496834-132496856 CTGGACGGATGCTGCCCGCCGGG + Intergenic
998454249 5:142258706-142258728 TTGGAGGGATGCCACAGACCAGG + Intergenic
1001279068 5:170372973-170372995 TGGGGGAGATGCAGCTGGCCTGG + Intronic
1002533430 5:179863078-179863100 ATGGAGGGACTCAGCTGGCCTGG + Exonic
1003391792 6:5719661-5719683 TTCCAGGGATGCGGCCAGCCAGG + Intronic
1006471581 6:34232299-34232321 GTGGAGGGATCCATCTGGCCAGG + Intergenic
1006788632 6:36684366-36684388 TTGGGAGGAGGCAGGCGGCCTGG + Exonic
1013316936 6:108952112-108952134 TTGGAGGGCTACAACTGGCCTGG - Intronic
1019812393 7:3174342-3174364 TTGGGGGGCTGCAGCCGGGTTGG - Intronic
1020342846 7:7131345-7131367 CTGGAGGGATGAAGCTAGCCTGG - Intergenic
1023799801 7:43824103-43824125 CTGGGGGGATGCTGCCGGCCTGG - Intergenic
1023938816 7:44757372-44757394 CTGCAGGTATGCAGGCGGCCCGG + Exonic
1025235321 7:57230758-57230780 TTGGAGGGATTCTGCCAGCTTGG - Intergenic
1035569879 8:665505-665527 TGGGCGGGATGGAGCCTGCCTGG - Intronic
1037490831 8:19395639-19395661 TTGGAGTGATGCAGCCGGAAGGG + Exonic
1037808038 8:22069302-22069324 TTGGAGGGATGCAGCCGGCCAGG + Intronic
1037898851 8:22675917-22675939 CTGGAGGGTTGCAGCCGGCCTGG - Intergenic
1038417013 8:27404505-27404527 TGGGAGGGATGCATCCAGACTGG - Intronic
1038480562 8:27898973-27898995 TGGGAGAGATGCAGAGGGCCAGG - Intronic
1041470984 8:58208831-58208853 GTGGAGGGATGCAGGCTCCCAGG - Intergenic
1043150031 8:76704192-76704214 TTGCAGGGATGGAGCCTGACAGG + Exonic
1044569489 8:93700865-93700887 TGGGTGGGTGGCAGCCGGCCGGG - Intronic
1047337690 8:123952308-123952330 CTGCAGGGAGGCAGCCAGCCTGG - Intronic
1049198660 8:141329387-141329409 CCGGAGGGAAGCAGCGGGCCTGG + Intergenic
1051834582 9:21321278-21321300 TTGGTGGGATACAGCTGGCTAGG - Intergenic
1051841099 9:21399140-21399162 CTGGTGGGATGCAGCTGGCCGGG + Intergenic
1053308784 9:37002387-37002409 TTGGATAGAAGCAGCGGGCCTGG - Intronic
1053885031 9:42637248-42637270 TTGCAGGCGTGCAGCCTGCCCGG + Intergenic
1054224052 9:62444699-62444721 TTGCAGGCGTGCAGCCTGCCCGG + Intergenic
1056376627 9:86020175-86020197 TTGGAGGGAAGCAGAGTGCCTGG + Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1187352714 X:18535807-18535829 TTGGAGGGACTCTGCAGGCCAGG - Intronic
1195758935 X:108225570-108225592 TTGGCAGGAGGCAGCCAGCCTGG - Intronic