ID: 1037808115

View in Genome Browser
Species Human (GRCh38)
Location 8:22069597-22069619
Sequence CGAGCATATACCCCAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037808115_1037808122 9 Left 1037808115 8:22069597-22069619 CCACTCTCTGGGGTATATGCTCG 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1037808122 8:22069629-22069651 TAAGTAGGCCCCAGGAGGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 208
1037808115_1037808118 -6 Left 1037808115 8:22069597-22069619 CCACTCTCTGGGGTATATGCTCG 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1037808118 8:22069614-22069636 TGCTCGCCTCAGGGCTAAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1037808115_1037808120 1 Left 1037808115 8:22069597-22069619 CCACTCTCTGGGGTATATGCTCG 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1037808120 8:22069621-22069643 CTCAGGGCTAAGTAGGCCCCAGG 0: 1
1: 0
2: 2
3: 30
4: 295
1037808115_1037808126 26 Left 1037808115 8:22069597-22069619 CCACTCTCTGGGGTATATGCTCG 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1037808126 8:22069646-22069668 GCCAGGACCCCTCCCAGAGATGG 0: 1
1: 0
2: 1
3: 25
4: 263
1037808115_1037808128 27 Left 1037808115 8:22069597-22069619 CCACTCTCTGGGGTATATGCTCG 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1037808128 8:22069647-22069669 CCAGGACCCCTCCCAGAGATGGG 0: 1
1: 0
2: 0
3: 16
4: 202
1037808115_1037808121 4 Left 1037808115 8:22069597-22069619 CCACTCTCTGGGGTATATGCTCG 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1037808121 8:22069624-22069646 AGGGCTAAGTAGGCCCCAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037808115 Original CRISPR CGAGCATATACCCCAGAGAG TGG (reversed) Intronic
906385210 1:45362384-45362406 GGTGCATTTACCTCAGAGAGAGG - Intronic
912061710 1:105680752-105680774 TGAGTATATACCCCAAAGAAAGG + Intergenic
919232053 1:194786217-194786239 CGAGCATTTAACCCATAGACTGG + Intergenic
919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG + Intronic
920963179 1:210681834-210681856 GGGGCATATGCCCTAGAGAGAGG - Exonic
921469375 1:215530432-215530454 TGGGCATATACCCCAAATAGTGG + Intergenic
1064419169 10:15175619-15175641 TGAGTATATACCCCAAAGAAAGG + Intergenic
1066279526 10:33901861-33901883 TGGGCATATACCCCAAAGAAAGG + Intergenic
1075297913 10:121294237-121294259 GGACCATACACCCCAGGGAGAGG + Intergenic
1077695758 11:4391571-4391593 CTAGCATATACCCCAAAGAAAGG + Intronic
1082637076 11:55609496-55609518 TGGGCATATACCCCAAAGAAAGG - Intergenic
1083263811 11:61537028-61537050 TGAGCAGAGAACCCAGAGAGGGG + Intronic
1083396167 11:62393641-62393663 CCAGCATTCACCCCAGACAGAGG + Intergenic
1084548383 11:69825856-69825878 CGTGCAGAGACCCCAGAGTGGGG - Intergenic
1084851316 11:71943348-71943370 CGAGCTTATAGCTCAGGGAGAGG + Intronic
1104140710 12:125983843-125983865 AGAGCAAATGCCCCACAGAGAGG - Intergenic
1105305976 13:19169523-19169545 TGAACAGATGCCCCAGAGAGTGG - Intergenic
1106079538 13:26488659-26488681 TAAGCATATGCCCCAGAGAGCGG + Intergenic
1108131707 13:47309052-47309074 TGGGCATATACCCCAAAGAAAGG - Intergenic
1110220954 13:73072698-73072720 GGAGCACATACTCCAGAGCGAGG - Intronic
1112937025 13:104813611-104813633 GGAGCAGATACCTCAGAGAGGGG - Intergenic
1115035623 14:28853359-28853381 AGATCATAGACCCCACAGAGTGG - Intergenic
1121092440 14:91192014-91192036 CAGGCATATACCCCAGAAAAAGG + Intronic
1124475486 15:30029750-30029772 CCAGTATATACCCCAAAGAAAGG - Intergenic
1128442531 15:67725564-67725586 TGAGCATATACCCAAGTGAATGG + Intronic
1130603481 15:85294248-85294270 TGGGCATATACCCCAAAGAATGG + Intergenic
1131285320 15:91052139-91052161 TGGGCATATACCCCAAAGAATGG - Intergenic
1133591671 16:7250577-7250599 AGAGTATATACCCCAGGGACGGG + Intronic
1143857891 17:9865924-9865946 CTGACATATACCCCAGAGAAAGG + Intronic
1144822972 17:18088352-18088374 CAAGCATCTGACCCAGAGAGAGG + Intronic
1147034837 17:37672177-37672199 CCAGCATAAGCCCCTGAGAGTGG - Intergenic
1147854623 17:43469725-43469747 CCAGCTTTTTCCCCAGAGAGGGG + Intergenic
1149147073 17:53506894-53506916 CAAGCATATACCCAAAAGAAAGG - Intergenic
1152771740 17:82174009-82174031 CCAGCATAGACCCCAGATACGGG + Intronic
1153808622 18:8732719-8732741 TGAGAATAAGCCCCAGAGAGAGG + Intronic
1154129715 18:11726528-11726550 CGAGGAGGTGCCCCAGAGAGGGG - Intronic
1159028216 18:63206138-63206160 CGAGCACATCCCCCTGGGAGAGG - Intronic
1164619857 19:29688419-29688441 TAGGCATATACCCAAGAGAGTGG - Intergenic
1167497421 19:49827796-49827818 GGAGCAGACAGCCCAGAGAGGGG + Intronic
928306695 2:30176149-30176171 AAAGCATATAGCCCAGAGACTGG + Intergenic
930363818 2:50413677-50413699 TGAGTATATACCCCAAAGAAAGG + Intronic
932055478 2:68438883-68438905 GGAGCAAGTACCCCAGAAAGAGG + Intergenic
936064853 2:109323117-109323139 CCAGCATATGCTCCAGAGAGAGG + Intronic
941013252 2:160325343-160325365 AGAGCATATACCTCAGTGAGGGG + Intronic
942237250 2:173922809-173922831 CTAGTATAGACTCCAGAGAGTGG + Intronic
942395893 2:175549156-175549178 TGAGCATGAACACCAGAGAGAGG - Intergenic
945923504 2:215780054-215780076 AGAGCATATACTGCAAAGAGAGG + Intergenic
1171304290 20:24091974-24091996 GGAGAATAAACCCCAGAGAGGGG + Intergenic
1174449075 20:50608883-50608905 TGAGGATTGACCCCAGAGAGTGG + Intronic
1174674064 20:52336594-52336616 AGAGTATATACCCCAGACAACGG - Intergenic
1181097310 22:20514293-20514315 AGAGCCTATAGCCCAGAGACAGG - Intronic
1183031692 22:35111228-35111250 CGAACAAAAACCCCAGAGACAGG + Intergenic
949156436 3:832203-832225 TGAGTATATACCCAAGAGAAAGG + Intergenic
954478428 3:50771938-50771960 TGGGTATATACCCCAAAGAGAGG + Intronic
955002170 3:54937704-54937726 CCAGAATTTACCACAGAGAGGGG + Intronic
956648743 3:71483377-71483399 CGAGCAGAAACACCAGAGAGCGG + Intronic
959793035 3:110387555-110387577 TGAGTATATACCCAGGAGAGAGG - Intergenic
966657923 3:182380521-182380543 AGAGCATATGCCCCAGAGTCAGG + Intergenic
969129638 4:4982049-4982071 CGTGCATACACCACACAGAGAGG - Intergenic
977311121 4:95388511-95388533 GGAGCATAAACCCTAAAGAGTGG - Intronic
979555945 4:122047715-122047737 CAAGCATAAGCCCCAGAGAGTGG - Intergenic
981441525 4:144788510-144788532 AGATCATTTACCCCAGAGACAGG - Intergenic
983389395 4:167110019-167110041 CAAGCAAATACCCTAGAGAGAGG - Intronic
984345718 4:178522180-178522202 AGAGCATATACACCAGAGGGTGG - Intergenic
986881771 5:12182542-12182564 AGAATATATACCCCAGAGAAGGG + Intergenic
988664925 5:33315977-33315999 CGAGCATTAAACCAAGAGAGGGG - Intergenic
992133975 5:73723895-73723917 CCAGAATCTACTCCAGAGAGTGG - Intronic
997417146 5:133737909-133737931 CGGGCATATACCCAAAAGAAAGG - Intergenic
1000044628 5:157511945-157511967 CCATCACATACCCCACAGAGGGG + Intronic
1008100313 6:47383708-47383730 TGAGTATATACCCCAAAGAAAGG - Intergenic
1008762594 6:54870858-54870880 CTTGCATATATCCAAGAGAGTGG + Intronic
1010529403 6:76948556-76948578 TGGGCATATACCCCAAAGAAAGG + Intergenic
1013342182 6:109225683-109225705 TTAGAATATAACCCAGAGAGGGG + Intergenic
1015135302 6:129862557-129862579 TGAGCATATACCCCAAAGAATGG - Intergenic
1015855856 6:137623651-137623673 CGACAATACACCCCACAGAGTGG - Intergenic
1016456961 6:144240763-144240785 TAAGCATATACCCCAAAGAAAGG - Intergenic
1017438287 6:154438634-154438656 AGAGCATATTCTTCAGAGAGAGG - Intronic
1018553329 6:165024155-165024177 CGATCACATCCCCCACAGAGTGG - Intergenic
1019779338 7:2930290-2930312 CCAGCAGATGCCACAGAGAGTGG - Intronic
1024446667 7:49487936-49487958 TGAGCCTAAACTCCAGAGAGAGG + Intergenic
1026927219 7:74202846-74202868 CGGGTATATACCCCAAAGAAAGG - Intronic
1028090860 7:86698972-86698994 AGAGGCTATACTCCAGAGAGGGG + Intronic
1030001230 7:105065484-105065506 GGAACATATACCCCAGGGAAAGG - Intronic
1030001607 7:105070182-105070204 TGGGCATTTAACCCAGAGAGGGG - Intronic
1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG + Intronic
1037808115 8:22069597-22069619 CGAGCATATACCCCAGAGAGTGG - Intronic
1042911190 8:73828084-73828106 CAAGCATATGCCCCAGAGTAAGG + Intronic
1043300812 8:78729255-78729277 GGAGCATATACCCTAGAAAAGGG - Intronic
1051792577 9:20823950-20823972 GGAAGATAGACCCCAGAGAGAGG + Intronic
1056217241 9:84416662-84416684 CCAGCCTACACCCCACAGAGTGG - Intergenic
1061408534 9:130405849-130405871 GGAGCATCCAGCCCAGAGAGGGG - Intronic
1061579955 9:131530730-131530752 CGAGCATACCCCCCAGGGGGCGG - Intronic
1186376449 X:9007165-9007187 TGAGCATATACTCCAAAGAACGG - Intergenic
1191908056 X:66116504-66116526 AGAGTATACAACCCAGAGAGTGG - Intergenic
1192358641 X:70425052-70425074 GGAGGAAATGCCCCAGAGAGAGG + Exonic
1193493758 X:82185183-82185205 CGAAAATATACACCAGAGAAAGG - Intergenic
1194776664 X:97973497-97973519 TGAGCATTTATCCCAGAGAAAGG - Intergenic
1195371335 X:104177467-104177489 CTTGAATATACCCCAAAGAGTGG + Intronic
1195497239 X:105550790-105550812 GGAGGATATACCACAAAGAGTGG + Intronic
1196729218 X:118924385-118924407 TGGGCATATACCCAAAAGAGAGG - Intergenic
1197452183 X:126633102-126633124 TGAGTATATACCCCAAAGAAAGG - Intergenic
1199048759 X:143210102-143210124 TGAGTGTATACCCCAAAGAGAGG + Intergenic