ID: 1037810016

View in Genome Browser
Species Human (GRCh38)
Location 8:22081509-22081531
Sequence AGGGTTTTTCCCCGGCGGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 97}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037810003_1037810016 7 Left 1037810003 8:22081479-22081501 CCGGGACGGCCCCCTTACCCCTG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037810001_1037810016 16 Left 1037810001 8:22081470-22081492 CCACCTGCTCCGGGACGGCCCCC 0: 1
1: 0
2: 2
3: 33
4: 330
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037809998_1037810016 19 Left 1037809998 8:22081467-22081489 CCCCCACCTGCTCCGGGACGGCC 0: 1
1: 0
2: 0
3: 45
4: 362
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037810000_1037810016 17 Left 1037810000 8:22081469-22081491 CCCACCTGCTCCGGGACGGCCCC 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037810010_1037810016 -10 Left 1037810010 8:22081496-22081518 CCCCTGCTGCTTCAGGGTTTTTC 0: 1
1: 1
2: 1
3: 33
4: 254
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037810007_1037810016 -4 Left 1037810007 8:22081490-22081512 CCCTTACCCCTGCTGCTTCAGGG 0: 1
1: 0
2: 1
3: 26
4: 284
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037809999_1037810016 18 Left 1037809999 8:22081468-22081490 CCCCACCTGCTCCGGGACGGCCC 0: 1
1: 0
2: 2
3: 16
4: 231
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037810005_1037810016 -3 Left 1037810005 8:22081489-22081511 CCCCTTACCCCTGCTGCTTCAGG 0: 1
1: 0
2: 3
3: 30
4: 321
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037810002_1037810016 13 Left 1037810002 8:22081473-22081495 CCTGCTCCGGGACGGCCCCCTTA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037810009_1037810016 -5 Left 1037810009 8:22081491-22081513 CCTTACCCCTGCTGCTTCAGGGT 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1037810004_1037810016 -2 Left 1037810004 8:22081488-22081510 CCCCCTTACCCCTGCTGCTTCAG 0: 1
1: 1
2: 1
3: 35
4: 343
Right 1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037810016 Original CRISPR AGGGTTTTTCCCCGGCGGGT TGG Exonic
901739733 1:11334410-11334432 AGGCTTCTTCCCCGGCTGGGTGG + Intergenic
912268203 1:108180932-108180954 AGGGCTTTTCCCTGGCTGTTAGG - Intronic
917975863 1:180237199-180237221 AGGGGTTTTACTCGGCGGGGGGG + Intronic
919334580 1:196215482-196215504 AGGGTTGTTCCCTGGCGGGCAGG + Intergenic
921212168 1:212910265-212910287 AGGTTTGTTCTCTGGCGGGTAGG - Intergenic
1064963926 10:20996236-20996258 AGGCCTTTTCCCCAGGGGGTAGG + Intronic
1066198782 10:33126919-33126941 ACGGTATTTCTCCTGCGGGTAGG - Intergenic
1067180429 10:43981486-43981508 AGGGGTTTTCCCAGGCTTGTAGG + Intergenic
1079343460 11:19632027-19632049 AGGCATGTTCCCTGGCGGGTGGG - Intronic
1079487429 11:20950044-20950066 AGGGTGTTTTCCCGGGAGGTAGG + Intronic
1081845055 11:46234656-46234678 TGGGTTTTTCCCCTGCTTGTCGG + Intergenic
1086319167 11:85627493-85627515 AGTGTTTTTCCTCGCCGGATAGG - Intronic
1087839885 11:102909668-102909690 GGGGTTGTTCTCTGGCGGGTAGG + Intergenic
1088821076 11:113457924-113457946 AGGGCTGTTCCCCAGTGGGTGGG + Intronic
1092605252 12:10111619-10111641 AGGCGCTTTCCCCGGTGGGTGGG + Intronic
1092761287 12:11813287-11813309 AGGGTGTGCCCCTGGCGGGTGGG - Intronic
1093301957 12:17470120-17470142 GGGGTTTTTCTCTGGCGGGCAGG - Intergenic
1094854169 12:34395547-34395569 AGGTACTTTCCCCCGCGGGTTGG - Intergenic
1100977782 12:100140512-100140534 AGGGTTTTTCCATGGTGGTTAGG - Intronic
1103322823 12:120101784-120101806 TGGGTTTTTCCCCAGGGGCTTGG - Intronic
1103364320 12:120370453-120370475 AGGGTTGTTCCCAGGCTGGAGGG - Intergenic
1104485167 12:129145342-129145364 AGGTTTTTTACTTGGCGGGTGGG + Intronic
1104592656 12:130097258-130097280 AGTGTTCTTCCCTGGCGTGTGGG + Intergenic
1108254238 13:48595194-48595216 AGGGTTGTTCTCTGGCGGGCAGG - Intergenic
1112237320 13:97648025-97648047 GGGGTTGTTCCCTGGCGGGCAGG - Intergenic
1113542132 13:111116546-111116568 AGGGTGTTTCTTCGGGGGGTGGG + Intronic
1115604027 14:34982590-34982612 AGGCTTGTTCCGCGGAGGGTGGG - Intronic
1124864461 15:33475360-33475382 AGAGTTTTTCCACGGATGGTGGG + Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1132341665 15:101082701-101082723 AGGGTCTTTCTCAGGCGGGAGGG - Intergenic
1144590163 17:16516881-16516903 AAGGTTTCTCCCAGGCGGGGCGG + Intergenic
1147044747 17:37744285-37744307 AGGGCTTTTCCCCGCGGGGCTGG - Intronic
1157785218 18:50475508-50475530 AGTGTTTTTCTCCGGGTGGTAGG - Intergenic
1160806995 19:996306-996328 GGGGTCGTCCCCCGGCGGGTCGG + Intronic
1163370021 19:16896645-16896667 AGGCTGGTTCCCCGGCGAGTCGG - Exonic
1167997087 19:53414500-53414522 TGGGCTTTTCCCCGGGGGGGGGG - Intronic
1168470626 19:56637980-56638002 AGGGCTTTCCCCAGGCGGATGGG + Intergenic
925906081 2:8540300-8540322 AGGGTTGTTCCACGGTGGGTAGG - Intergenic
936387105 2:112040483-112040505 GGGGTTGTTCTCCGGCGGGCAGG - Intergenic
942148199 2:173047230-173047252 AGTGTTTTTCCCCAGGGGATAGG + Intronic
1168820039 20:766601-766623 GGGGTTGTTCCCTGGCGGGCAGG - Intronic
1169905673 20:10600884-10600906 AGGGTATGTTCCAGGCGGGTGGG - Intronic
1171182845 20:23103644-23103666 AGAATTTTTCCTTGGCGGGTAGG + Intergenic
1176685819 21:9847712-9847734 AGGATTGTTCTCCGGCGGGCAGG - Intergenic
1179015583 21:37592268-37592290 AGGGTTGTTCTCTGGCGGGCCGG + Intergenic
1179982063 21:44900777-44900799 AGGGTTTTTCCCCTTGGGGATGG - Intronic
1182257726 22:29050403-29050425 AGGGCTCTGGCCCGGCGGGTGGG + Exonic
1183358068 22:37369964-37369986 TGAGTTTTTCCCAGGCGGGAGGG - Exonic
1184241415 22:43212928-43212950 AGGGGCTGTCCCCGGGGGGTAGG + Intronic
1185028839 22:48431169-48431191 AGGGTTTCTTCCCGGAGGGTGGG + Intergenic
963228295 3:142885454-142885476 AAGGTTTTTCCCACGCTGGTTGG - Intronic
970474550 4:16409231-16409253 ATGGTTCTTCCCCAGGGGGTTGG + Intergenic
976696187 4:87922062-87922084 GGGGTTGTTCTCTGGCGGGTAGG - Intergenic
980349279 4:131666189-131666211 AGGGTTGTTCTCTGGCGGGCAGG - Intergenic
989423944 5:41274144-41274166 AGTGTTTTTCCCCAGGGGATGGG + Intergenic
992251739 5:74882945-74882967 AGGGTTGTTCTCTGGCGGGCTGG + Intergenic
995539969 5:113175967-113175989 AGTGTTTTTTCCCTGCTGGTTGG - Intronic
1001579279 5:172787956-172787978 GGGGTTTTTCTCTGGCGGGCAGG - Intergenic
1002324222 5:178394904-178394926 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324245 5:178394992-178395014 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324268 5:178395080-178395102 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324291 5:178395168-178395190 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324314 5:178395256-178395278 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324336 5:178395344-178395366 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324358 5:178395432-178395454 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324380 5:178395520-178395542 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324402 5:178395608-178395630 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324424 5:178395696-178395718 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324446 5:178395784-178395806 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324468 5:178395872-178395894 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324511 5:178396048-178396070 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324533 5:178396136-178396158 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324555 5:178396224-178396246 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324577 5:178396312-178396334 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324600 5:178396400-178396422 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324623 5:178396488-178396510 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324646 5:178396576-178396598 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324669 5:178396664-178396686 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324691 5:178396752-178396774 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002324713 5:178396840-178396862 AGAGTCTCTCCCCGGCGGGCAGG + Intronic
1002775317 6:323518-323540 CAGGTTTTTCCCCGGCTAGTGGG + Intronic
1006301400 6:33195222-33195244 TGGGTTTTTCCTCGGCCAGTTGG + Intronic
1020354884 7:7265229-7265251 AGGGCTTTTCCCTGGAGGCTTGG - Intergenic
1022572298 7:31467020-31467042 GGGGTTTTTCTCCGGTGGGCAGG + Intergenic
1022709560 7:32838091-32838113 GGGGTTTTTCTCCGGTGGGCAGG - Intergenic
1026794165 7:73355158-73355180 AGGCTGCTTCCACGGCGGGTGGG - Intronic
1027816441 7:82978165-82978187 AGAGTTTTTGCCGGGGGGGTGGG - Intronic
1031355555 7:120782646-120782668 GGGGTTTTTCTCTGGCGGGCAGG + Intergenic
1031421951 7:121563807-121563829 GGGGTTTTTCTCTGGCGGGCAGG + Intergenic
1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG + Exonic
1039893947 8:41703015-41703037 AGGGTTTTGCCCTGGAGTGTTGG + Intronic
1043596922 8:81898188-81898210 AGGGTTGTTCTCTGGCGGGCAGG + Intergenic
1043597727 8:81903738-81903760 AGGGTTGTTCTCTGGCGGGCAGG + Intergenic
1045810629 8:106216138-106216160 TGGGTTTTTCCCAGGAGGGAGGG - Intergenic
1047856870 8:128920128-128920150 GGGGTTTTTCTCTGGCGGGCAGG - Intergenic
1049672291 8:143875319-143875341 AGGGTTTTGCCAAGGTGGGTAGG - Intronic
1055069198 9:72149339-72149361 AGGATTTTTCTCCCGCGAGTTGG - Exonic
1056656547 9:88514309-88514331 GGGGTTGTTCCCTGGCGGGCAGG + Intergenic
1193154819 X:78160855-78160877 AGGGTTGTTCTCTGGCGGGAAGG + Intergenic
1195291584 X:103435210-103435232 GGGGTTGTTCTCTGGCGGGTGGG + Intergenic
1200610666 Y:5324957-5324979 GGGGTTGTTCCCTGGCGGGCAGG + Intronic