ID: 1037811407

View in Genome Browser
Species Human (GRCh38)
Location 8:22089219-22089241
Sequence CGCTTTCGCCCGGGAGCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10305
Summary {0: 1, 1: 0, 2: 4, 3: 310, 4: 9990}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811396_1037811407 2 Left 1037811396 8:22089194-22089216 CCTCCGCCTAGAGCGCTGCCGCC 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG 0: 1
1: 0
2: 4
3: 310
4: 9990
1037811394_1037811407 16 Left 1037811394 8:22089180-22089202 CCACGGGGCTGCCTCCTCCGCCT 0: 1
1: 0
2: 7
3: 42
4: 464
Right 1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG 0: 1
1: 0
2: 4
3: 310
4: 9990
1037811392_1037811407 25 Left 1037811392 8:22089171-22089193 CCGCCGGGGCCACGGGGCTGCCT 0: 1
1: 0
2: 1
3: 24
4: 248
Right 1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG 0: 1
1: 0
2: 4
3: 310
4: 9990
1037811398_1037811407 -4 Left 1037811398 8:22089200-22089222 CCTAGAGCGCTGCCGCCGCCGCT 0: 1
1: 0
2: 4
3: 28
4: 264
Right 1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG 0: 1
1: 0
2: 4
3: 310
4: 9990
1037811395_1037811407 5 Left 1037811395 8:22089191-22089213 CCTCCTCCGCCTAGAGCGCTGCC 0: 1
1: 0
2: 0
3: 8
4: 176
Right 1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG 0: 1
1: 0
2: 4
3: 310
4: 9990
1037811397_1037811407 -1 Left 1037811397 8:22089197-22089219 CCGCCTAGAGCGCTGCCGCCGCC 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG 0: 1
1: 0
2: 4
3: 310
4: 9990
1037811393_1037811407 22 Left 1037811393 8:22089174-22089196 CCGGGGCCACGGGGCTGCCTCCT 0: 1
1: 0
2: 4
3: 39
4: 430
Right 1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG 0: 1
1: 0
2: 4
3: 310
4: 9990

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811407 Original CRISPR CGCTTTCGCCCGGGAGCCGG GGG Exonic
Too many off-targets to display for this crispr