ID: 1037811568

View in Genome Browser
Species Human (GRCh38)
Location 8:22089677-22089699
Sequence GTGGAGCGGAGGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811568_1037811574 -5 Left 1037811568 8:22089677-22089699 CCTGCCTCCTTCCTCCGCTCCAC No data
Right 1037811574 8:22089695-22089717 TCCACCCCACCGCCTCGCCTGGG No data
1037811568_1037811582 25 Left 1037811568 8:22089677-22089699 CCTGCCTCCTTCCTCCGCTCCAC No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811568_1037811573 -6 Left 1037811568 8:22089677-22089699 CCTGCCTCCTTCCTCCGCTCCAC No data
Right 1037811573 8:22089694-22089716 CTCCACCCCACCGCCTCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811568 Original CRISPR GTGGAGCGGAGGAAGGAGGC AGG (reversed) Intronic