ID: 1037811570

View in Genome Browser
Species Human (GRCh38)
Location 8:22089684-22089706
Sequence CGGTGGGGTGGAGCGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811570_1037811582 18 Left 1037811570 8:22089684-22089706 CCTTCCTCCGCTCCACCCCACCG No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811570 Original CRISPR CGGTGGGGTGGAGCGGAGGA AGG (reversed) Intronic