ID: 1037811571

View in Genome Browser
Species Human (GRCh38)
Location 8:22089688-22089710
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811571_1037811582 14 Left 1037811571 8:22089688-22089710 CCTCCGCTCCACCCCACCGCCTC No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811571 Original CRISPR GAGGCGGTGGGGTGGAGCGG AGG (reversed) Intronic