ID: 1037811578

View in Genome Browser
Species Human (GRCh38)
Location 8:22089701-22089723
Sequence TTCAAGCCCAGGCGAGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811578_1037811582 1 Left 1037811578 8:22089701-22089723 CCACCGCCTCGCCTGGGCTTGAA No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811578_1037811589 25 Left 1037811578 8:22089701-22089723 CCACCGCCTCGCCTGGGCTTGAA No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811578 Original CRISPR TTCAAGCCCAGGCGAGGCGG TGG (reversed) Intronic