ID: 1037811578 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:22089701-22089723 |
Sequence | TTCAAGCCCAGGCGAGGCGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037811578_1037811589 | 25 | Left | 1037811578 | 8:22089701-22089723 | CCACCGCCTCGCCTGGGCTTGAA | No data | ||
Right | 1037811589 | 8:22089749-22089771 | CTGATCTCCCAGACAACTCCAGG | 0: 1 1: 0 2: 12 3: 16 4: 170 |
||||
1037811578_1037811582 | 1 | Left | 1037811578 | 8:22089701-22089723 | CCACCGCCTCGCCTGGGCTTGAA | No data | ||
Right | 1037811582 | 8:22089725-22089747 | AAATCGCCGTCCCTTCCCCTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037811578 | Original CRISPR | TTCAAGCCCAGGCGAGGCGG TGG (reversed) | Intronic | ||