ID: 1037811581

View in Genome Browser
Species Human (GRCh38)
Location 8:22089712-22089734
Sequence ACGGCGATTTTTTCAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811581_1037811594 26 Left 1037811581 8:22089712-22089734 CCTGGGCTTGAAAAAATCGCCGT No data
Right 1037811594 8:22089761-22089783 ACAACTCCAGGACCTTGTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1037811581_1037811592 24 Left 1037811581 8:22089712-22089734 CCTGGGCTTGAAAAAATCGCCGT No data
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129
1037811581_1037811593 25 Left 1037811581 8:22089712-22089734 CCTGGGCTTGAAAAAATCGCCGT No data
Right 1037811593 8:22089760-22089782 GACAACTCCAGGACCTTGTTGGG 0: 1
1: 0
2: 0
3: 4
4: 97
1037811581_1037811582 -10 Left 1037811581 8:22089712-22089734 CCTGGGCTTGAAAAAATCGCCGT No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811581_1037811589 14 Left 1037811581 8:22089712-22089734 CCTGGGCTTGAAAAAATCGCCGT No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811581 Original CRISPR ACGGCGATTTTTTCAAGCCC AGG (reversed) Intronic