ID: 1037811582

View in Genome Browser
Species Human (GRCh38)
Location 8:22089725-22089747
Sequence AAATCGCCGTCCCTTCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811570_1037811582 18 Left 1037811570 8:22089684-22089706 CCTTCCTCCGCTCCACCCCACCG No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811568_1037811582 25 Left 1037811568 8:22089677-22089699 CCTGCCTCCTTCCTCCGCTCCAC No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811580_1037811582 -5 Left 1037811580 8:22089707-22089729 CCTCGCCTGGGCTTGAAAAAATC No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811576_1037811582 3 Left 1037811576 8:22089699-22089721 CCCCACCGCCTCGCCTGGGCTTG No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811571_1037811582 14 Left 1037811571 8:22089688-22089710 CCTCCGCTCCACCCCACCGCCTC No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811579_1037811582 -2 Left 1037811579 8:22089704-22089726 CCGCCTCGCCTGGGCTTGAAAAA No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811569_1037811582 21 Left 1037811569 8:22089681-22089703 CCTCCTTCCTCCGCTCCACCCCA No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811577_1037811582 2 Left 1037811577 8:22089700-22089722 CCCACCGCCTCGCCTGGGCTTGA No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811578_1037811582 1 Left 1037811578 8:22089701-22089723 CCACCGCCTCGCCTGGGCTTGAA No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811572_1037811582 11 Left 1037811572 8:22089691-22089713 CCGCTCCACCCCACCGCCTCGCC No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811575_1037811582 6 Left 1037811575 8:22089696-22089718 CCACCCCACCGCCTCGCCTGGGC No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data
1037811581_1037811582 -10 Left 1037811581 8:22089712-22089734 CCTGGGCTTGAAAAAATCGCCGT No data
Right 1037811582 8:22089725-22089747 AAATCGCCGTCCCTTCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811582 Original CRISPR AAATCGCCGTCCCTTCCCCT CGG Intronic