ID: 1037811584

View in Genome Browser
Species Human (GRCh38)
Location 8:22089735-22089757
Sequence GGAGATCAGACCGAGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811584_1037811589 -9 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811584_1037811598 30 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1037811584_1037811594 3 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811594 8:22089761-22089783 ACAACTCCAGGACCTTGTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1037811584_1037811593 2 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811593 8:22089760-22089782 GACAACTCCAGGACCTTGTTGGG 0: 1
1: 0
2: 0
3: 4
4: 97
1037811584_1037811596 9 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811596 8:22089767-22089789 CCAGGACCTTGTTGGGGTGCAGG 0: 1
1: 0
2: 3
3: 19
4: 243
1037811584_1037811592 1 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811584 Original CRISPR GGAGATCAGACCGAGGGGAA GGG (reversed) Intronic