ID: 1037811589

View in Genome Browser
Species Human (GRCh38)
Location 8:22089749-22089771
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 12, 3: 16, 4: 170}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811577_1037811589 26 Left 1037811577 8:22089700-22089722 CCCACCGCCTCGCCTGGGCTTGA No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811579_1037811589 22 Left 1037811579 8:22089704-22089726 CCGCCTCGCCTGGGCTTGAAAAA No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811580_1037811589 19 Left 1037811580 8:22089707-22089729 CCTCGCCTGGGCTTGAAAAAATC No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811581_1037811589 14 Left 1037811581 8:22089712-22089734 CCTGGGCTTGAAAAAATCGCCGT No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811578_1037811589 25 Left 1037811578 8:22089701-22089723 CCACCGCCTCGCCTGGGCTTGAA No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811583_1037811589 -5 Left 1037811583 8:22089731-22089753 CCGTCCCTTCCCCTCGGTCTGAT No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811576_1037811589 27 Left 1037811576 8:22089699-22089721 CCCCACCGCCTCGCCTGGGCTTG No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811585_1037811589 -10 Left 1037811585 8:22089736-22089758 CCTTCCCCTCGGTCTGATCTCCC No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811575_1037811589 30 Left 1037811575 8:22089696-22089718 CCACCCCACCGCCTCGCCTGGGC No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170
1037811584_1037811589 -9 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811589 8:22089749-22089771 CTGATCTCCCAGACAACTCCAGG 0: 1
1: 0
2: 12
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type