ID: 1037811592

View in Genome Browser
Species Human (GRCh38)
Location 8:22089759-22089781
Sequence AGACAACTCCAGGACCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811584_1037811592 1 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129
1037811587_1037811592 -5 Left 1037811587 8:22089741-22089763 CCCTCGGTCTGATCTCCCAGACA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129
1037811588_1037811592 -6 Left 1037811588 8:22089742-22089764 CCTCGGTCTGATCTCCCAGACAA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129
1037811580_1037811592 29 Left 1037811580 8:22089707-22089729 CCTCGCCTGGGCTTGAAAAAATC No data
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129
1037811586_1037811592 -4 Left 1037811586 8:22089740-22089762 CCCCTCGGTCTGATCTCCCAGAC No data
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129
1037811583_1037811592 5 Left 1037811583 8:22089731-22089753 CCGTCCCTTCCCCTCGGTCTGAT No data
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129
1037811581_1037811592 24 Left 1037811581 8:22089712-22089734 CCTGGGCTTGAAAAAATCGCCGT No data
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129
1037811585_1037811592 0 Left 1037811585 8:22089736-22089758 CCTTCCCCTCGGTCTGATCTCCC No data
Right 1037811592 8:22089759-22089781 AGACAACTCCAGGACCTTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811592 Original CRISPR AGACAACTCCAGGACCTTGT TGG Intronic