ID: 1037811594

View in Genome Browser
Species Human (GRCh38)
Location 8:22089761-22089783
Sequence ACAACTCCAGGACCTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811585_1037811594 2 Left 1037811585 8:22089736-22089758 CCTTCCCCTCGGTCTGATCTCCC No data
Right 1037811594 8:22089761-22089783 ACAACTCCAGGACCTTGTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1037811581_1037811594 26 Left 1037811581 8:22089712-22089734 CCTGGGCTTGAAAAAATCGCCGT No data
Right 1037811594 8:22089761-22089783 ACAACTCCAGGACCTTGTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1037811587_1037811594 -3 Left 1037811587 8:22089741-22089763 CCCTCGGTCTGATCTCCCAGACA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1037811594 8:22089761-22089783 ACAACTCCAGGACCTTGTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1037811583_1037811594 7 Left 1037811583 8:22089731-22089753 CCGTCCCTTCCCCTCGGTCTGAT No data
Right 1037811594 8:22089761-22089783 ACAACTCCAGGACCTTGTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1037811586_1037811594 -2 Left 1037811586 8:22089740-22089762 CCCCTCGGTCTGATCTCCCAGAC No data
Right 1037811594 8:22089761-22089783 ACAACTCCAGGACCTTGTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1037811584_1037811594 3 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811594 8:22089761-22089783 ACAACTCCAGGACCTTGTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1037811588_1037811594 -4 Left 1037811588 8:22089742-22089764 CCTCGGTCTGATCTCCCAGACAA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1037811594 8:22089761-22089783 ACAACTCCAGGACCTTGTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811594 Original CRISPR ACAACTCCAGGACCTTGTTG GGG Intronic