ID: 1037811598

View in Genome Browser
Species Human (GRCh38)
Location 8:22089788-22089810
Sequence GGACGCCCTTCCCGTCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811585_1037811598 29 Left 1037811585 8:22089736-22089758 CCTTCCCCTCGGTCTGATCTCCC No data
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1037811595_1037811598 -2 Left 1037811595 8:22089767-22089789 CCAGGACCTTGTTGGGGTGCAGG 0: 1
1: 1
2: 1
3: 18
4: 199
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1037811591_1037811598 8 Left 1037811591 8:22089757-22089779 CCAGACAACTCCAGGACCTTGTT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1037811587_1037811598 24 Left 1037811587 8:22089741-22089763 CCCTCGGTCTGATCTCCCAGACA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1037811597_1037811598 -8 Left 1037811597 8:22089773-22089795 CCTTGTTGGGGTGCAGGACGCCC 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1037811586_1037811598 25 Left 1037811586 8:22089740-22089762 CCCCTCGGTCTGATCTCCCAGAC No data
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1037811590_1037811598 9 Left 1037811590 8:22089756-22089778 CCCAGACAACTCCAGGACCTTGT 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1037811584_1037811598 30 Left 1037811584 8:22089735-22089757 CCCTTCCCCTCGGTCTGATCTCC No data
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1037811588_1037811598 23 Left 1037811588 8:22089742-22089764 CCTCGGTCTGATCTCCCAGACAA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1037811598 8:22089788-22089810 GGACGCCCTTCCCGTCACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811598 Original CRISPR GGACGCCCTTCCCGTCACCC CGG Intronic