ID: 1037811599

View in Genome Browser
Species Human (GRCh38)
Location 8:22089789-22089811
Sequence GACGCCCTTCCCGTCACCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037811597_1037811599 -7 Left 1037811597 8:22089773-22089795 CCTTGTTGGGGTGCAGGACGCCC 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1037811599 8:22089789-22089811 GACGCCCTTCCCGTCACCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 107
1037811585_1037811599 30 Left 1037811585 8:22089736-22089758 CCTTCCCCTCGGTCTGATCTCCC No data
Right 1037811599 8:22089789-22089811 GACGCCCTTCCCGTCACCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 107
1037811595_1037811599 -1 Left 1037811595 8:22089767-22089789 CCAGGACCTTGTTGGGGTGCAGG 0: 1
1: 1
2: 1
3: 18
4: 199
Right 1037811599 8:22089789-22089811 GACGCCCTTCCCGTCACCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 107
1037811587_1037811599 25 Left 1037811587 8:22089741-22089763 CCCTCGGTCTGATCTCCCAGACA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1037811599 8:22089789-22089811 GACGCCCTTCCCGTCACCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 107
1037811586_1037811599 26 Left 1037811586 8:22089740-22089762 CCCCTCGGTCTGATCTCCCAGAC No data
Right 1037811599 8:22089789-22089811 GACGCCCTTCCCGTCACCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 107
1037811591_1037811599 9 Left 1037811591 8:22089757-22089779 CCAGACAACTCCAGGACCTTGTT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1037811599 8:22089789-22089811 GACGCCCTTCCCGTCACCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 107
1037811590_1037811599 10 Left 1037811590 8:22089756-22089778 CCCAGACAACTCCAGGACCTTGT 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1037811599 8:22089789-22089811 GACGCCCTTCCCGTCACCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 107
1037811588_1037811599 24 Left 1037811588 8:22089742-22089764 CCTCGGTCTGATCTCCCAGACAA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1037811599 8:22089789-22089811 GACGCCCTTCCCGTCACCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037811599 Original CRISPR GACGCCCTTCCCGTCACCCC GGG Intronic