ID: 1037813279

View in Genome Browser
Species Human (GRCh38)
Location 8:22098934-22098956
Sequence CTGGGTAACCTGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037813279_1037813290 15 Left 1037813279 8:22098934-22098956 CCCTCTTCCTTCAGGTTACCCAG 0: 1
1: 0
2: 2
3: 23
4: 277
Right 1037813290 8:22098972-22098994 GGCTTCCTTCCCTGGCAAGGAGG 0: 1
1: 0
2: 3
3: 23
4: 277
1037813279_1037813289 12 Left 1037813279 8:22098934-22098956 CCCTCTTCCTTCAGGTTACCCAG 0: 1
1: 0
2: 2
3: 23
4: 277
Right 1037813289 8:22098969-22098991 TGAGGCTTCCTTCCCTGGCAAGG 0: 1
1: 1
2: 4
3: 29
4: 297
1037813279_1037813282 -6 Left 1037813279 8:22098934-22098956 CCCTCTTCCTTCAGGTTACCCAG 0: 1
1: 0
2: 2
3: 23
4: 277
Right 1037813282 8:22098951-22098973 ACCCAGTGCCCCGTCTGATGAGG 0: 1
1: 0
2: 1
3: 4
4: 88
1037813279_1037813288 7 Left 1037813279 8:22098934-22098956 CCCTCTTCCTTCAGGTTACCCAG 0: 1
1: 0
2: 2
3: 23
4: 277
Right 1037813288 8:22098964-22098986 TCTGATGAGGCTTCCTTCCCTGG 0: 1
1: 0
2: 1
3: 28
4: 305
1037813279_1037813292 21 Left 1037813279 8:22098934-22098956 CCCTCTTCCTTCAGGTTACCCAG 0: 1
1: 0
2: 2
3: 23
4: 277
Right 1037813292 8:22098978-22099000 CTTCCCTGGCAAGGAGGCCTTGG 0: 1
1: 0
2: 1
3: 31
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037813279 Original CRISPR CTGGGTAACCTGAAGGAAGA GGG (reversed) Exonic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
902892551 1:19454942-19454964 CTTGGTAAAGGGAAGGAAGAGGG + Intronic
903783996 1:25844757-25844779 CTGGGAAGCATAAAGGAAGAAGG - Intronic
905389686 1:37628480-37628502 CAGGGAAACATGAAGCAAGAGGG + Intronic
908020649 1:59894511-59894533 GTGGGTGAACTGAAGGCAGAAGG + Intronic
908381897 1:63604755-63604777 CTGGGTAACTGGAAGGAATCTGG - Intronic
908486132 1:64595578-64595600 CTGGGGCACATGAAGAAAGACGG - Intronic
908512041 1:64857417-64857439 ATGGGTCCCATGAAGGAAGAAGG + Intronic
908815470 1:68028446-68028468 CTGGGTAACATAAAGGAAAGAGG + Intergenic
909060454 1:70873244-70873266 CTGGTAAACCTAAAGAAAGAAGG - Intronic
913072135 1:115309101-115309123 CTGGGATACCTGAAGCAATAAGG + Intronic
913195040 1:116449234-116449256 CTGGGGTACCTGCAGGAAGTGGG - Intergenic
913291317 1:117274795-117274817 GTGGGTCACCTGAAGAAAGGGGG + Intergenic
915222452 1:154385762-154385784 CTGGGAACCCTGAGGGCAGAGGG + Intergenic
916277800 1:163013957-163013979 CTGAGAGACCTGAATGAAGATGG - Intergenic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
919848331 1:201655565-201655587 CTGGGCCTCCTGAAGGAAGCAGG + Intronic
919881753 1:201905650-201905672 ATGGGTCACAGGAAGGAAGAAGG - Intronic
920387619 1:205579936-205579958 CGGGCTTACCTGGAGGAAGACGG - Exonic
920559609 1:206930025-206930047 ATGGGTCCCTTGAAGGAAGAGGG - Exonic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
1063123646 10:3122392-3122414 CTGTGGACCCTGAAGGGAGAGGG + Intronic
1063354478 10:5385291-5385313 CTGGGTAAGATAAAGGAAGTGGG - Intergenic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1066095921 10:32071968-32071990 CTGTGTAACCCGCAGGGAGAGGG - Intergenic
1066509613 10:36082186-36082208 CTGGGGTACCTGAAGGAAACAGG - Intergenic
1067083731 10:43227497-43227519 CTGGGGAAGCTGAAAGAAGGTGG + Intronic
1068584562 10:58782700-58782722 CTGGAAAACCTGATTGAAGAGGG + Intronic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069631717 10:69901326-69901348 CTGGAAAACCTGTAGGCAGATGG - Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1071256169 10:83873764-83873786 GTGGGAAACATGAAGAAAGATGG - Intergenic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072740349 10:97905371-97905393 CTGGGTAACCTAGAGCTAGAGGG - Intronic
1073223761 10:101898539-101898561 CTGAGATACCTGAAGGAAGCAGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1074533095 10:114310435-114310457 CTGGATGACCTGAGGCAAGAGGG + Exonic
1075133414 10:119760329-119760351 CTTGGGAGGCTGAAGGAAGAAGG + Intronic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1078449234 11:11428057-11428079 CTGGGCTAACGGAAGGAAGAGGG - Intronic
1079893905 11:26094403-26094425 CTGAGGAACATGAAGGTAGAAGG - Intergenic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1080667920 11:34352025-34352047 CTGGGTAGTCTGAAGGATGAGGG - Intronic
1082186273 11:49185675-49185697 CTGGGTAACCTGGTGTGAGAGGG + Exonic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1082742810 11:56929557-56929579 CTGTGTAATCTGAAGAAAGTTGG + Intergenic
1083690425 11:64404943-64404965 CTGGCTGAACTGGAGGAAGAGGG - Intergenic
1083946997 11:65929248-65929270 TGGGGTGGCCTGAAGGAAGAAGG - Intergenic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1085524908 11:77158409-77158431 CTGGGCAACCTGCAGTATGAGGG + Exonic
1086388011 11:86329415-86329437 CTTTGTATCCTGAAGGATGAAGG + Intronic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1086680058 11:89659696-89659718 CTGGGTAACCTGGTGTGAGAGGG - Intergenic
1088120227 11:106360553-106360575 CTGGGTAACTGAAAGGATGATGG - Intergenic
1091262719 11:134246599-134246621 CTGTGTAACCTATAGGGAGAGGG - Exonic
1091998674 12:5015863-5015885 CTGGCTCACCTGAGGGCAGAGGG - Intergenic
1094395574 12:30001966-30001988 CTGGATAACCTGAGGGAATGAGG + Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1096575270 12:52548863-52548885 CTGGGTTCCCTGAGTGAAGAAGG + Intronic
1097093187 12:56523972-56523994 CTGGGTAACCTGAGAGAACTAGG - Intronic
1098457169 12:70687661-70687683 TTGGGTGACCTAAAGGAAGTAGG + Intronic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1100315751 12:93442578-93442600 CAGGGTAGGCTGAAGGAAAAGGG + Intergenic
1101797489 12:107988870-107988892 CTGGTTAACATGAGGGAAAATGG + Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101932974 12:109030064-109030086 CAGCGTAACTTGCAGGAAGAAGG - Intronic
1102609402 12:114098185-114098207 CTGAGCCACCTGGAGGAAGATGG + Intergenic
1102655981 12:114482571-114482593 TTGGATAACCTGATGGAAGCTGG - Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1104601325 12:130155740-130155762 CTGGTTAAATTCAAGGAAGAAGG + Intergenic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104755273 12:131265260-131265282 CTGGGTAACTTCAAAGAAAAGGG + Intergenic
1105837978 13:24227117-24227139 CTGGGTGAGATGAAGGATGAAGG + Intronic
1108588707 13:51893438-51893460 CTGGTGAAGCTAAAGGAAGAGGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1112119010 13:96388916-96388938 CTGGGTAACTTAAAGGAAAGAGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1115554339 14:34532536-34532558 ATAGGAAACCTAAAGGAAGAGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117755274 14:58968433-58968455 CTGGGCAGCATGATGGAAGAAGG - Intergenic
1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG + Intronic
1120674455 14:87404719-87404741 CTGGGTAACTTAAAAGAAAAAGG - Intergenic
1120746837 14:88159816-88159838 TGGGGGATCCTGAAGGAAGAGGG - Intergenic
1121050136 14:90815042-90815064 CTGGGTAGTCTGAAGTGAGAAGG + Intronic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1125361305 15:38867346-38867368 CTGGATAACCTGCAGGTAGCTGG - Intergenic
1125931630 15:43604342-43604364 CAGGGTGAGATGAAGGAAGAAGG - Exonic
1125944734 15:43703822-43703844 CAGGGTGAGATGAAGGAAGAAGG - Intergenic
1126430697 15:48580734-48580756 CTGGGTAGCCTGAAGTGACATGG - Intronic
1126865691 15:52934436-52934458 CTGAGTAACCTAAAGGAACAGGG - Intergenic
1127760893 15:62138087-62138109 CTAGGTCACCTCAAGGAAGGAGG - Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128563413 15:68683249-68683271 GTGGGGAGCCTGAAGGACGAAGG + Intronic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1130042877 15:80419496-80419518 CTGGGTGATCTGGAGGGAGAAGG + Intronic
1130321245 15:82843976-82843998 GAGGGTAACATGAAGGGAGAAGG + Intronic
1131258887 15:90878282-90878304 CTGGCTAACCCCACGGAAGAAGG - Exonic
1133184892 16:4088975-4088997 CTGGGGAAACTGAAGGGAAATGG - Intronic
1134095034 16:11413406-11413428 CTGGGTAATCTGAAACAGGAGGG + Intronic
1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG + Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1139491163 16:67286746-67286768 CAGGTTAACCTCAAGGAACAGGG + Exonic
1139834067 16:69824241-69824263 CCTGGTAGTCTGAAGGAAGAGGG - Intronic
1141087538 16:81107659-81107681 CTGGGCTGCCTGCAGGAAGAGGG - Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1142739926 17:1925934-1925956 CGTGGTACCCTGTAGGAAGAAGG + Intergenic
1143579998 17:7819885-7819907 ATGAGGACCCTGAAGGAAGAGGG - Intronic
1143646627 17:8234597-8234619 CTGGCCACCCTGAAAGAAGAAGG - Exonic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144402636 17:14920985-14921007 ATTGGTAAATTGAAGGAAGATGG + Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1147215412 17:38896310-38896332 CTGGGTCCCCTGAAGGGAGCTGG - Intronic
1147333872 17:39715432-39715454 ATAGGTAACCTGCAGGCAGAGGG - Exonic
1148678363 17:49458285-49458307 ATGGGTAGCCTGAAGGATGTGGG - Intronic
1148707195 17:49645837-49645859 ATGGGAAACGTCAAGGAAGAAGG - Intronic
1149891151 17:60391800-60391822 GTGGGTAACCGGGAGGGAGAGGG - Intronic
1150446652 17:65231787-65231809 CTGGGAAGGCTGAAGGAAGCCGG + Intergenic
1150472125 17:65446352-65446374 CTGGGAAGGCTGCAGGAAGAGGG + Intergenic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152915182 17:83030894-83030916 CTGGGAACCCTGAAGGGCGAAGG + Intronic
1156326733 18:36080231-36080253 CTGGGAGACCTGAAGACAGATGG + Intergenic
1157046137 18:44103841-44103863 ATGGGTAACCTGGAGGCAGCAGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158718821 18:59905145-59905167 ATGGGAAACGTGAGGGAAGAAGG + Intergenic
1159699897 18:71613256-71613278 CTGGGTAATATGAAGGAATAAGG - Intergenic
1159810310 18:73011445-73011467 CTTGTTAACCTGAAGAAGGAGGG - Intergenic
1160076088 18:75679227-75679249 TGGGGTCACCTGAAGGAACAGGG - Intergenic
1161068589 19:2249777-2249799 CCGGCCCACCTGAAGGAAGACGG - Intronic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164675581 19:30098227-30098249 ATGGGTAATCTGAAGGATCAAGG - Intergenic
1165328739 19:35129191-35129213 TTGGATAACTTGAATGAAGAGGG + Intronic
1166547552 19:43642376-43642398 CAGGGTACCCTGAAGTAGGATGG - Intergenic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
925783189 2:7402868-7402890 CTGGGTGCCCTGAAGGAAAAGGG + Intergenic
927251383 2:20997734-20997756 CTGTGTAACTTGAAGGACTATGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
928703396 2:33922109-33922131 CAGGATAACCTAAAGGAAGTAGG - Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
934778472 2:96953923-96953945 CTGGGAAGCCTGGAGGAAAAGGG + Intronic
936650767 2:114423473-114423495 CTGGTGAACCTCAGGGAAGAAGG + Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937539140 2:122926693-122926715 CTGGGGATCCTGGAGGGAGAGGG + Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
941213915 2:162681317-162681339 CTGGGTGACCTTTAGGAAGAAGG + Intronic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
946057012 2:216911361-216911383 CAGGGTAACATGAAGGACAAAGG - Intergenic
946087300 2:217186906-217186928 CTGGGGAAGCTGGAGGAAGCAGG - Intergenic
946254941 2:218435448-218435470 CTTGGTAACCTGGAGGCGGAGGG - Intronic
946298433 2:218805906-218805928 CTGAGGAGCATGAAGGAAGAAGG + Intronic
946937837 2:224739682-224739704 CTTGGTAAACTGAAGCAAGAGGG - Intergenic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
1168736337 20:141426-141448 CTGGGTATCATGGAGGTAGAGGG + Intergenic
1168903189 20:1383184-1383206 CTGGGTAACAGGACTGAAGAAGG + Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169457635 20:5766171-5766193 TTAGGTAACATGAAGGGAGAAGG + Intronic
1169612388 20:7396644-7396666 ATGGTTAACCTGAAGGCATACGG - Intergenic
1169758415 20:9067503-9067525 CTGGGCATCCTTAAGCAAGAGGG - Intergenic
1169985414 20:11437933-11437955 CTTTGTAAAATGAAGGAAGAAGG + Intergenic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1172598606 20:36168080-36168102 CTGGGTGGCCTGCAGGGAGAGGG - Intronic
1173143663 20:40506558-40506580 CTGGGCACCCTGAAGGTTGAAGG - Intergenic
1173257991 20:41408645-41408667 GTGGGTAGGCTGCAGGAAGAGGG - Intronic
1173855776 20:46249813-46249835 CTTGGAAACCTGAAGGTAGCTGG - Intronic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1179044351 21:37831438-37831460 CTGGGTTACCTGCAGGACCAGGG - Intronic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1184372894 22:44093927-44093949 GTGAGTGACCTGCAGGAAGAAGG + Exonic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
950141682 3:10620298-10620320 CTGGGAACTCTGGAGGAAGACGG + Intronic
950218809 3:11178813-11178835 CTGGGAAACCTGAGCTAAGACGG + Intronic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
952883544 3:37999450-37999472 CTGGGTTAGCTGGGGGAAGATGG + Intronic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954156513 3:48687819-48687841 CTGGGTAACCTTCAGGATGCTGG + Intergenic
954156988 3:48691002-48691024 CTAGGTAACCTAGAGGAAGAGGG - Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956589572 3:70899460-70899482 CTAGTTAGCCTCAAGGAAGATGG - Intergenic
961575440 3:127832135-127832157 TTGTGAAACATGAAGGAAGAAGG + Intergenic
964319474 3:155480040-155480062 CTTGGTTCCCTGAAGGAAAAGGG + Exonic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
968689040 4:1980678-1980700 CTGGGGACCCTGATGGGAGAAGG - Exonic
969272593 4:6112989-6113011 CTTGGGATCCTGAAGGAAGGAGG + Exonic
969316026 4:6381724-6381746 CTGAGTGACCTGAAGAAACATGG - Intronic
972433363 4:39006536-39006558 CTTTTTAACCTTAAGGAAGAAGG - Intronic
976556117 4:86453173-86453195 CTGGGAAAGCTGCAGGGAGAAGG + Intronic
978729859 4:112013096-112013118 CTGGGACACCTGTAGGAAGAAGG + Intergenic
982233402 4:153230027-153230049 CAGGCTAACCTGAGAGAAGAAGG + Intronic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984455163 4:179957370-179957392 ATGAGGAACCTGAGGGAAGAGGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987748574 5:22009196-22009218 CTGGGAAGCCTGAAAGAACATGG - Intronic
989431927 5:41365627-41365649 CTGGGTAACCTGAAGAGTGCTGG + Intronic
989512491 5:42304625-42304647 CTAGGTAACCTGAAGCAAGATGG - Intergenic
991396499 5:66209608-66209630 CTGGGCTACCTGGAGGAAGTTGG + Intergenic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
991768754 5:70018994-70019016 CTGGGAAGCCTGAAAGAACATGG - Intergenic
991847992 5:70894071-70894093 CTGGGAAGCCTGAAAGAACATGG - Intergenic
992868530 5:80982429-80982451 ATGTTTAACCTGTAGGAAGAAGG + Intronic
993431277 5:87834670-87834692 AAGGGAAACCTGAAAGAAGAGGG + Intergenic
993787437 5:92160469-92160491 CTGGGTAATGTGAAGAAAGGAGG - Intergenic
994525945 5:100904487-100904509 CTGTTCAACCTGAAGGAACACGG - Intergenic
996481200 5:123976631-123976653 CAGGTTAGCCTGCAGGAAGAAGG - Intergenic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996491142 5:124098929-124098951 AGAGGTAAGCTGAAGGAAGAAGG + Intergenic
997192532 5:131951328-131951350 TTGGGAAATCTGAAGCAAGAAGG + Exonic
999443895 5:151623516-151623538 TTGGGGAAGCTGAAGCAAGAGGG + Intergenic
1002473433 5:179451051-179451073 CCGGGGAACCTGGCGGAAGAGGG - Intergenic
1003303770 6:4908263-4908285 CTGGTTAACCTGATGGGAAAGGG + Intronic
1003459355 6:6315861-6315883 CTGGGTGAACTGCATGAAGATGG + Intronic
1003601142 6:7518675-7518697 CTGGGTTCCCTGATGGAAGAGGG - Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1008946363 6:57101374-57101396 CTGTGTCCCATGAAGGAAGAAGG - Intronic
1010758686 6:79697504-79697526 CTGGCATACCTGTAGGAAGAAGG + Intronic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013937666 6:115617570-115617592 GTAGGTAACCTGAAGGAAACTGG + Intergenic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1014778002 6:125533014-125533036 CTGGATGACCTGAAAGCAGATGG - Intergenic
1018079553 6:160247175-160247197 CTGGCTCACCTGAAGGGAGGCGG + Exonic
1019688558 7:2396501-2396523 CTGGGAAACATGAAGGCAGCTGG - Intergenic
1020029739 7:4924516-4924538 CTGGGTACCCTCAAGGCAGCAGG - Intronic
1020264170 7:6549333-6549355 CTGAGTCACCTGCAGGAAGTAGG - Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1028693684 7:93683141-93683163 TTGTGTAACATGAAGGCAGAAGG - Intronic
1030120476 7:106105756-106105778 CTGGGTATCCTGAAGGTAAGGGG + Intronic
1033141668 7:138832533-138832555 CTGAAAAACCTGGAGGAAGAAGG + Intronic
1033533642 7:142291304-142291326 CTGGGTAATATTAAGGAAGAAGG - Intergenic
1033936336 7:146590221-146590243 CTGGGTAACCTGCATAAAGTGGG - Intronic
1034151956 7:148924059-148924081 CATGGTAACCTATAGGAAGAAGG - Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1036743995 8:11391134-11391156 CTGGGTAAGCTGATGCAAGAGGG - Intronic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037819412 8:22128563-22128585 CTGCCTAAGCTGAAGGCAGAGGG + Exonic
1038673490 8:29601506-29601528 CTGGGTAACTTGATGAAAGAGGG - Intergenic
1038757920 8:30359209-30359231 TTGGGTAATTGGAAGGAAGAGGG - Intergenic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1047722984 8:127659423-127659445 CTGATTTCCCTGAAGGAAGAAGG - Intergenic
1048045540 8:130769082-130769104 CTGGGGACCCTGAAGATAGATGG + Intergenic
1049013112 8:139900891-139900913 CTGGGAAACATGAAGCCAGATGG + Intronic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1051889506 9:21927830-21927852 ATGGCTAACCAGAAGGAAGGGGG + Intronic
1053246732 9:36540787-36540809 TTGGGTAATCTGAATGCAGAGGG + Intergenic
1053246938 9:36542329-36542351 TTGGGTAATCTGAATGTAGAGGG + Intergenic
1054862479 9:69968075-69968097 GTGGGCAACCTAAAGTAAGAAGG - Intergenic
1057220971 9:93257526-93257548 ATGGGTAAGCTGAGGGCAGATGG - Intronic
1057402960 9:94740786-94740808 CTGTGTAACCTTAAGCAAGCTGG + Intronic
1058137671 9:101325375-101325397 ATGGGTAGGCTGAAGGTAGAGGG - Intergenic
1058581796 9:106466642-106466664 CTGGGTAATTTGAAGAAAGGAGG - Intergenic
1058880417 9:109280914-109280936 CTGGGTAACCTAAGAGTAGACGG + Intronic
1059474372 9:114532633-114532655 CTGGCTAAACTGAAAGAATAGGG + Intergenic
1060414757 9:123422331-123422353 CTAGGAAACCTGTAGGTAGAGGG - Intronic
1060652474 9:125340425-125340447 CTGTGTAACTTTGAGGAAGAGGG + Intronic
1062259849 9:135656072-135656094 CTGGGGAACTTGACAGAAGAGGG + Intergenic
1185752618 X:2626229-2626251 GTTGGTTACCTGAAGGGAGATGG + Intergenic
1187217185 X:17288558-17288580 CTGGCCAATCTGAAGGAAGGTGG + Intergenic
1187268043 X:17755408-17755430 CTGGGCCATCTGAAGGCAGAGGG - Intergenic
1187321207 X:18238875-18238897 CTGGGCCATCTGAAGGCAGAGGG + Intergenic
1187348342 X:18488505-18488527 CTGGTCAACCAGAAAGAAGAAGG + Intronic
1189242973 X:39540003-39540025 CTGGGAAGCCTGGAAGAAGAAGG + Intergenic
1189261492 X:39682136-39682158 CTTGGTGACCTGCAGGAAGCAGG - Intergenic
1190199217 X:48345701-48345723 CTGGGGAACATGAAGGAATGAGG - Intergenic
1190210588 X:48443675-48443697 CTGGGTAACGTGGAGGAATCAGG + Intergenic
1192000841 X:67149741-67149763 TTGGGTTACCTGAAGGAAATGGG - Intergenic
1193369754 X:80680575-80680597 CTGGAAAACCTTAAGGAAGGTGG + Intronic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195678195 X:107523399-107523421 CTGGGCCACCTGCAGGAAGATGG + Intronic
1197379655 X:125723976-125723998 CTTGGTAACCTAAATGTAGATGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic