ID: 1037813302

View in Genome Browser
Species Human (GRCh38)
Location 8:22099035-22099057
Sequence CCGTGTGTGCCTCTGTGATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 233}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037813302_1037813310 -3 Left 1037813302 8:22099035-22099057 CCTCATCACAGAGGCACACACGG 0: 1
1: 0
2: 1
3: 19
4: 233
Right 1037813310 8:22099055-22099077 CGGTGAGCAGGGGCGGGCGGAGG 0: 1
1: 2
2: 7
3: 80
4: 642
1037813302_1037813312 2 Left 1037813302 8:22099035-22099057 CCTCATCACAGAGGCACACACGG 0: 1
1: 0
2: 1
3: 19
4: 233
Right 1037813312 8:22099060-22099082 AGCAGGGGCGGGCGGAGGCCGGG 0: 1
1: 1
2: 8
3: 68
4: 785
1037813302_1037813309 -6 Left 1037813302 8:22099035-22099057 CCTCATCACAGAGGCACACACGG 0: 1
1: 0
2: 1
3: 19
4: 233
Right 1037813309 8:22099052-22099074 ACACGGTGAGCAGGGGCGGGCGG 0: 1
1: 0
2: 4
3: 54
4: 385
1037813302_1037813308 -9 Left 1037813302 8:22099035-22099057 CCTCATCACAGAGGCACACACGG 0: 1
1: 0
2: 1
3: 19
4: 233
Right 1037813308 8:22099049-22099071 CACACACGGTGAGCAGGGGCGGG 0: 1
1: 0
2: 4
3: 30
4: 329
1037813302_1037813307 -10 Left 1037813302 8:22099035-22099057 CCTCATCACAGAGGCACACACGG 0: 1
1: 0
2: 1
3: 19
4: 233
Right 1037813307 8:22099048-22099070 GCACACACGGTGAGCAGGGGCGG 0: 1
1: 0
2: 2
3: 11
4: 196
1037813302_1037813311 1 Left 1037813302 8:22099035-22099057 CCTCATCACAGAGGCACACACGG 0: 1
1: 0
2: 1
3: 19
4: 233
Right 1037813311 8:22099059-22099081 GAGCAGGGGCGGGCGGAGGCCGG 0: 1
1: 0
2: 5
3: 140
4: 1169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037813302 Original CRISPR CCGTGTGTGCCTCTGTGATG AGG (reversed) Exonic
900191373 1:1353672-1353694 CTGTGTCTCCCACTGTGATGAGG - Intronic
900215573 1:1479825-1479847 CGGTGTGTGCCTGTGTGAAGGGG - Intronic
900230868 1:1556680-1556702 CCTTGTGTGGCTCTGTGTTGAGG - Intronic
900309243 1:2025380-2025402 CCATGTTGGCCTCTGAGATGTGG - Exonic
900337728 1:2172870-2172892 CCGTGTGTGCGTGTGTGAAACGG + Intronic
900337734 1:2172915-2172937 CCGTGTGTGCGTGTGTGAAACGG + Intronic
900337740 1:2172960-2172982 CCGTGTGTGCGTGTGTGAAACGG + Intronic
900596454 1:3482289-3482311 CTGTGTGTGCGTGTGTGTTGGGG + Intergenic
900642003 1:3692097-3692119 ACGTGTTTGCCTGTGTGTTGTGG + Intronic
900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG + Intergenic
900840233 1:5042720-5042742 CCGTGTGGCCCTGTGTGGTGTGG + Intergenic
902628220 1:17689054-17689076 CAGTGTCTGCATCTGTAATGTGG - Intronic
902801566 1:18833198-18833220 CCATGCGATCCTCTGTGATGGGG - Intergenic
904474697 1:30757360-30757382 CCGTTTCTGCCTCTGTGAGATGG - Intronic
906714157 1:47954665-47954687 ATGTGTGTGCCTGTGTGTTGCGG + Intronic
911380805 1:97111565-97111587 CCGAGAGTGCCTCTCTGAGGAGG - Intronic
913527701 1:119709783-119709805 TCTTCTGAGCCTCTGTGATGTGG + Intronic
919453845 1:197800801-197800823 CCCTGGGAGCCACTGTGATGAGG + Intergenic
922199849 1:223392948-223392970 ACGTGTGTACCTCTGCAATGTGG - Intergenic
922540317 1:226414299-226414321 GGGTGTGTGCCCCTGCGATGGGG + Intergenic
922541416 1:226423100-226423122 CCTTGTGTGACTCTGGAATGAGG - Intergenic
922791257 1:228312328-228312350 CTGTGTCTCCCTCTGTGATCAGG + Intronic
923201332 1:231715167-231715189 ACCTGTCTGTCTCTGTGATGAGG + Intronic
1063356821 10:5408407-5408429 CTGTGTGTGTATGTGTGATGTGG - Intergenic
1063573112 10:7235046-7235068 CCGTGTGTGCCACTGGCCTGGGG - Intronic
1064506075 10:16031609-16031631 GCGTGTGTGTGTATGTGATGGGG - Intergenic
1065178556 10:23102135-23102157 GCGTGTGTGTCTCAGTGTTGGGG - Intronic
1065269072 10:24008282-24008304 CCTTCTATCCCTCTGTGATGTGG - Intronic
1066388225 10:34958493-34958515 CCCTGTGTGCATTTGGGATGTGG + Intergenic
1069710191 10:70483087-70483109 CCATGTCTGGTTCTGTGATGGGG + Intronic
1072557429 10:96531705-96531727 TTGTGTGTGCCTCTGTTTTGGGG - Intronic
1075591959 10:123698385-123698407 CCGTGAGAGCCACTGTGATGTGG - Intergenic
1076278774 10:129227356-129227378 GCATGTGTGCCCCTGTGGTGGGG + Intergenic
1076293895 10:129369103-129369125 TCATGTGTGCATGTGTGATGGGG - Intergenic
1076307504 10:129475331-129475353 CTGTGTGTGTCTGGGTGATGGGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077306285 11:1870030-1870052 CCGTTTGTGCATCTGTAATGGGG + Intronic
1078048864 11:7944803-7944825 CTGTGGGTGCCTCAGTGTTGTGG + Intergenic
1078511021 11:11984042-11984064 CCATGTCTGTCTCTGTGACGAGG + Intronic
1081157229 11:39708434-39708456 CTGTGTGTGCCTCTGTGTGTTGG - Intergenic
1083854404 11:65385574-65385596 ACATGTGTGCATCTGAGATGTGG - Intergenic
1084155216 11:67309463-67309485 CAATGTGCGCCTCTGGGATGAGG + Exonic
1084608933 11:70188569-70188591 CCCTGTGTGGCTCAGGGATGAGG - Exonic
1085700013 11:78737410-78737432 ACATGTGTGCCTCTTAGATGGGG - Intronic
1089739693 11:120573871-120573893 CAGTGTGGGCCTCTGGGATGTGG - Intronic
1090355480 11:126137706-126137728 CTGTGTGTGTCTATGTGTTGGGG - Intergenic
1091294834 11:134466401-134466423 CCGTGCGTGCGTCTGTGTGGAGG + Intergenic
1091634121 12:2184533-2184555 ATGTGTTTGCCTCTCTGATGAGG + Intronic
1092108345 12:5940440-5940462 AAGTGTGTGCCTCAATGATGGGG - Intronic
1093239020 12:16646040-16646062 CTGTATGTGCCTCTGTAAAGTGG + Intergenic
1094123864 12:27002041-27002063 ACGTGTGTGCGTGTGTGTTGTGG - Intronic
1096373908 12:51091633-51091655 ATGTGTGTGCATGTGTGATGGGG + Intergenic
1097190573 12:57217495-57217517 CCGTGTGTGCGTGTGTGCTCGGG - Intronic
1098306468 12:69107523-69107545 CCTTTTGTACCTCTGTGATGTGG - Intergenic
1099252297 12:80271163-80271185 CCGTGGGTTCCTCTGTGAGAAGG - Intronic
1104045570 12:125160286-125160308 CCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1104838133 12:131805367-131805389 CCCTGGGTGCCTCTGGGCTGGGG + Intergenic
1106088152 13:26561323-26561345 CCGTGTGTGTGTATGTGGTGGGG + Intronic
1106583771 13:31039235-31039257 GCATGTGTGCCTCTGTGGTGGGG + Intergenic
1106628329 13:31443385-31443407 GTGTGTGTGACTCTGTGAGGTGG - Intergenic
1109294917 13:60518340-60518362 CAGTGTGTCCCTCTCAGATGTGG - Intronic
1112029991 13:95448097-95448119 ATGTGTGTGCCTGTGTGGTGTGG - Intronic
1115753250 14:36510651-36510673 CCGTGTGTGCTGCTGAGATCAGG + Intronic
1118735227 14:68696347-68696369 CCGACTGTGCCTGTGTGCTGAGG - Intronic
1119765777 14:77186821-77186843 CTGTGTGTGTCTGTGTGGTGTGG + Intronic
1120192652 14:81453140-81453162 CCATTTCTGCCTCTGTGTTGTGG - Intergenic
1121503775 14:94460868-94460890 CCGTGTGGCCCTGTGTGGTGGGG + Intergenic
1122845882 14:104498644-104498666 CCATGTGTGCTGCTGTGCTGTGG - Intronic
1127190100 15:56520447-56520469 CACTGTGTGCCTTTCTGATGGGG - Intergenic
1127804423 15:62505810-62505832 CCTTGTCTGCCTCTATGATGGGG + Intronic
1129377899 15:75145597-75145619 CCCTGGGAGCCACTGTGATGAGG - Intergenic
1129856612 15:78829687-78829709 TAGTGGGTGCCTCTGTCATGAGG + Intronic
1129936916 15:79458367-79458389 CCGTGTGGGCCTCAATGAGGAGG + Exonic
1131380229 15:91957427-91957449 CCATGAGGCCCTCTGTGATGGGG + Intronic
1132226317 15:100144572-100144594 CCGTGACTGCCACTGTGATTAGG - Intronic
1132309847 15:100849559-100849581 GCGTGTTTGCCGTTGTGATGCGG + Intergenic
1132886020 16:2182375-2182397 ATGTGTGTGGCCCTGTGATGTGG - Intronic
1133246244 16:4450698-4450720 CTGTGTGTGTTTCTGTGCTGAGG + Intronic
1133510129 16:6450074-6450096 CCTTTTGTGCCTCTTTGAGGAGG + Intronic
1137868896 16:51930399-51930421 GCGTGTGTGTGTGTGTGATGAGG - Intergenic
1137970163 16:52976743-52976765 CTCTGTGTGACTCTGTGCTGAGG + Intergenic
1137977559 16:53044153-53044175 CTCTGTGTCCCTCTGAGATGGGG - Intergenic
1139273919 16:65709290-65709312 CAGGGTGTCCTTCTGTGATGTGG - Intergenic
1142033044 16:87847878-87847900 ACGTGTGTGCCACTGGGCTGTGG - Intronic
1142130586 16:88429996-88430018 CGTTGAGCGCCTCTGTGATGAGG - Exonic
1143949827 17:10623695-10623717 CTGGGTGCGCCTGTGTGATGAGG + Intergenic
1144729104 17:17516642-17516664 CCGTGTGTGCTTTGGGGATGGGG + Intronic
1145251036 17:21297177-21297199 CGGTGCGTGGCTCTGAGATGGGG + Intronic
1149363699 17:55919815-55919837 CCTTGTGTCCTTCTGTGTTGTGG - Intergenic
1149524621 17:57345170-57345192 CCGTGTGTTCCTCAGTCATTTGG + Intronic
1151504726 17:74520296-74520318 CCATGTCTGCCTCTCTGGTGAGG + Intergenic
1151727572 17:75893621-75893643 CCGTTTCCTCCTCTGTGATGTGG - Intronic
1152246423 17:79187020-79187042 CAGTGTGTACCTCTGTGAAATGG + Intronic
1154356172 18:13624548-13624570 CCGATTGTGCCTTTGGGATGGGG + Intronic
1156848585 18:41699192-41699214 CTGTGTGTGTATATGTGATGAGG + Intergenic
1158204394 18:54975497-54975519 CTCTGTGTGTCTCTGTGCTGTGG + Intergenic
1160089109 18:75809248-75809270 GCGTGTGTGTGTGTGTGATGTGG + Intergenic
1161085281 19:2332334-2332356 CCGTCTGTGCCTGTGTGCTGGGG + Intronic
1161504212 19:4635491-4635513 CCGTGTGTGCCCCTGTGGGTGGG - Intergenic
1162321498 19:9973549-9973571 CGGTGAGTGACTGTGTGATGTGG - Exonic
1162525031 19:11201888-11201910 CCGTGTGTGCCACCGGGAGGAGG - Exonic
1163680236 19:18677275-18677297 CCCTGTGTGCCTGTGGAATGTGG - Intergenic
1164733210 19:30521237-30521259 CCGTGTGTCTCCCTGTGTTGAGG + Intronic
1164770132 19:30801996-30802018 CGTTGTGTGCCTCTGCGAAGGGG - Intergenic
1164784683 19:30920599-30920621 CACTGTGTACCTCGGTGATGAGG - Intergenic
1165068360 19:33241577-33241599 CCGTGTGGGCCTATGGGAAGGGG - Intergenic
1165092705 19:33395173-33395195 TCCTGTGGGCCTCTGTGGTGAGG + Intronic
1165382195 19:35489360-35489382 CCGTGTTGGGCTCTGTCATGGGG - Intronic
1165685702 19:37817763-37817785 CCGGGCGTGCCTGTGTGACGTGG + Intergenic
1167222308 19:48208373-48208395 CTGTGTGTGCCTATGAGATTGGG - Exonic
1168452427 19:56476990-56477012 CCGTGTGTGCCTGTGTGTGAGGG - Intronic
1168454248 19:56493549-56493571 CATTGGGTGCCTCTGTGTTGAGG + Intergenic
1168559523 19:57371357-57371379 CCGTGTGGCCCTGTGTTATGTGG - Intronic
925040380 2:728444-728466 CCGTGTGTGCATGTGTGCAGTGG + Intergenic
926293313 2:11548353-11548375 ATGTGTGTGCATCTGTGTTGGGG - Intronic
926631905 2:15144168-15144190 CTGTGTGTGCATATGTGTTGGGG - Intergenic
927464628 2:23327946-23327968 CTGTGTGTGCCTGTGTGTGGCGG + Intergenic
927934046 2:27065254-27065276 CCTGCTGTTCCTCTGTGATGAGG + Intronic
931838692 2:66126913-66126935 CAGTGTCTGCCTCTGTGACTTGG - Intergenic
933025511 2:77252744-77252766 CGTTGCGTGCCTCTGAGATGGGG + Intronic
935804514 2:106732680-106732702 CCGTGTGAAGCTGTGTGATGGGG + Intergenic
935981744 2:108634951-108634973 CCCTGTTTGCCTCTTTGCTGGGG + Intronic
937261939 2:120592024-120592046 CAGTGCTTCCCTCTGTGATGAGG - Intergenic
938939571 2:136157975-136157997 AAGTGTGTGCATGTGTGATGGGG + Intergenic
942201768 2:173578333-173578355 CAGTATGTGCTTCTGTGAAGAGG + Intergenic
943385363 2:187197627-187197649 CAGTGTGTGGCTCTGGGGTGGGG + Intergenic
945428385 2:209735993-209736015 CCATGGGTACCTCTGAGATGGGG + Intergenic
945786136 2:214240020-214240042 CACTGTGTGCCTATGTGAGGTGG + Intronic
946403116 2:219479185-219479207 CCGTGTGTGAGTCTGAGGTGAGG + Exonic
948537529 2:238657414-238657436 CCATGCGTGCCTCTGAGATATGG + Intergenic
948839737 2:240643057-240643079 CCGTGTGTGCCTCAGTCCTGAGG + Intergenic
1170693331 20:18634868-18634890 CCCTCTGTGCACCTGTGATGGGG - Intronic
1171779814 20:29408799-29408821 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
1172099736 20:32477963-32477985 ACGTGGGTGCCTGTGTTATGGGG - Intronic
1172875146 20:38159606-38159628 CAGTGTGTTCCTCTGTGAAATGG - Intronic
1173039917 20:39452565-39452587 GTGTGTGTGCCTCTGGGATCTGG - Intergenic
1174220207 20:48948378-48948400 CTGTGTGTGCCTCTGTACAGGGG - Intronic
1179409415 21:41150913-41150935 CCATGTGTGTGTGTGTGATGGGG + Intergenic
1179419133 21:41222123-41222145 CAGTGTTTGCATCTGTGACGTGG + Intronic
1179506349 21:41844500-41844522 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179506395 21:41844668-41844690 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179506410 21:41844752-41844774 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179506419 21:41844781-41844803 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179506428 21:41844810-41844832 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179506455 21:41844893-41844915 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179506473 21:41844949-41844971 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179506493 21:41845005-41845027 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179506543 21:41845154-41845176 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179506573 21:41845237-41845259 CTGTGTGTGTCCCTGTGAGGGGG - Intronic
1179946605 21:44682216-44682238 AGGTGTGTGCTTCTGTGCTGTGG - Intronic
1180185808 21:46138668-46138690 CTGTGTGTGCCGCTGTGCTCAGG - Intronic
1180324865 22:11361271-11361293 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
1180854871 22:19039364-19039386 CCGTGTCTGCCTTTGTGAGATGG - Intronic
1181441592 22:22938807-22938829 CTGTGTACTCCTCTGTGATGTGG + Intergenic
1182367047 22:29786212-29786234 GCTTCTGTGCCTCTGTGAGGTGG - Intergenic
1184424823 22:44403218-44403240 CCCTCTCTGCCTGTGTGATGGGG + Intergenic
1184968470 22:47998209-47998231 GGGTGTGTGCCTGTGTGTTGGGG - Intergenic
1185140216 22:49095818-49095840 CCGTGTGTGCATGTGTGTTGGGG - Intergenic
954654351 3:52184904-52184926 ACATGTGTGCCTCTGTGACAAGG + Intergenic
961450561 3:127000490-127000512 CCGTCTGTGCCCCTGTGCTCTGG + Intronic
961646776 3:128397024-128397046 CCCAGGGTGCCTCTGTGTTGTGG - Intronic
962971585 3:140406611-140406633 ACATGTGTGCCTCTGTGGTGGGG - Intronic
966208316 3:177427233-177427255 CCGTGTGTGCCTCTCTGAAGTGG + Intergenic
967333260 3:188313923-188313945 GTGTGTGTGCCTCTGTGTTTGGG + Intronic
968566425 4:1315910-1315932 CCGTGTGTGTGTCTGCGCTGTGG + Intronic
969408181 4:7008989-7009011 CCTTTTGTCCCTCTGTGATTTGG + Intronic
969590921 4:8121534-8121556 CCCTGTCTGCCTCTGTGTGGGGG - Intronic
969681511 4:8645786-8645808 CCGTGGCTCCCGCTGTGATGTGG + Intergenic
971077321 4:23164938-23164960 GCGTGTGTGCATGTGTGGTGGGG - Intergenic
972981426 4:44707896-44707918 CCTTGTGTGCCCCTGTTATAAGG + Exonic
973535878 4:51881449-51881471 CCCCATTTGCCTCTGTGATGTGG + Intronic
974549392 4:63350762-63350784 CCTTCAGTGCCTCTGTGATAAGG - Intergenic
979652304 4:123149646-123149668 TTGTGTGTGCCTATGTGAGGTGG - Intronic
980072398 4:128258097-128258119 CAAGGAGTGCCTCTGTGATGGGG + Intergenic
983328575 4:166292462-166292484 CAGGATGTGCCTCTGTCATGGGG + Intergenic
984942272 4:184943283-184943305 CGGAGAATGCCTCTGTGATGTGG - Intergenic
985445647 4:190019887-190019909 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
985547093 5:515216-515238 CCGTTTGTGCTGCTGTGCTGGGG - Intronic
985555706 5:556951-556973 CCCTCTGTGCCTCTTTGCTGTGG + Intergenic
985647111 5:1090181-1090203 CCCTGTTTGCTTTTGTGATGTGG - Intronic
985747476 5:1655322-1655344 CCCTGTGTGCTGCTCTGATGCGG - Intergenic
992034542 5:72759563-72759585 CCGGGTGTGTCTTTGAGATGAGG - Intergenic
996230656 5:121059640-121059662 GAGTGTGTGCCTATCTGATGAGG - Intergenic
997510236 5:134448968-134448990 CTGTGTATGCTTCTGTAATGTGG - Intergenic
998097089 5:139402116-139402138 CTGTGTGTCCCTCTGAGAAGGGG - Intronic
999195332 5:149777870-149777892 CTGTGTGTGTGTCTGTGGTGGGG - Intronic
1001150008 5:169219124-169219146 TCATGTGTGCCTCTGTCCTGGGG - Intronic
1003256992 6:4483244-4483266 CTGTGTGTGTCTGTGTGGTGGGG - Intergenic
1003572945 6:7267957-7267979 ACGTGTGTGCCTCTGTCAGGTGG + Intergenic
1005306350 6:24517845-24517867 CTGTGTATGCCTCAGTTATGAGG - Intronic
1006316953 6:33297091-33297113 CCCTGTGTCCGTCTGGGATGAGG - Exonic
1006897727 6:37481510-37481532 GCCTGTGTGGCTCTGTGTTGGGG + Intronic
1009047489 6:58248171-58248193 GGGTATATGCCTCTGTGATGTGG - Intergenic
1011651597 6:89511283-89511305 CAGTGTGTGCCTCTGAGAAATGG - Intronic
1014457374 6:121651609-121651631 ACGTGTCTGCTGCTGTGATGTGG - Intergenic
1014643550 6:123944950-123944972 CTGTGTGTGCATGTGTGTTGGGG - Intronic
1018840065 6:167510070-167510092 CCCTGTGTCCCTGTGAGATGGGG - Intergenic
1019190830 6:170249651-170249673 CAGTGTGTGTCTCTGAGCTGGGG - Intergenic
1019599126 7:1872716-1872738 CCGTGTCTGGCCCTGTGCTGGGG - Intronic
1020496738 7:8862877-8862899 CAGTGAGTGCTTCTGTGAAGTGG + Intergenic
1023862132 7:44223182-44223204 TCGTGTGTGCCTGTGTTGTGTGG + Intronic
1024182212 7:46907986-46908008 CAGTGTGTGCCTGTGTGCAGAGG + Intergenic
1024675173 7:51631739-51631761 CTGTGTGTGCCTGTGTGTGGTGG - Intergenic
1029625809 7:101719441-101719463 CTCTGTGTCCCTCTGTCATGGGG + Intergenic
1032165192 7:129539789-129539811 CTGTGTGAGCCTGTGTGGTGTGG + Intergenic
1032239862 7:130152381-130152403 TGGTGTGTGTTTCTGTGATGTGG - Intergenic
1032688017 7:134255807-134255829 CCGTGTGTGCATGGGGGATGAGG + Intronic
1034062663 7:148107347-148107369 CCCTGTGTGTCTCTGTGATTCGG - Intronic
1034064711 7:148125169-148125191 TGGTGTGTGCCTCTGGGATGGGG - Intronic
1035249133 7:157585520-157585542 CCGTGGGTGCCTTTGTGATCAGG + Intronic
1035344925 7:158191676-158191698 TCTTGGGTGGCTCTGTGATGCGG + Intronic
1037184117 8:16041058-16041080 CCCTGTGTGACTCTCTCATGAGG - Intergenic
1037348296 8:17923080-17923102 ACGTGTGGGCCTCTCTGCTGCGG + Exonic
1037813302 8:22099035-22099057 CCGTGTGTGCCTCTGTGATGAGG - Exonic
1040728298 8:50410296-50410318 CAGTGAGTAGCTCTGTGATGTGG - Intronic
1040877258 8:52166572-52166594 CTGTGTGGCCCTCTGTGCTGTGG + Intronic
1046888505 8:119395963-119395985 GCCTCTGTGCCTCTGTGAAGTGG - Intergenic
1048293014 8:133194645-133194667 GCGTGTGTGCGTGTGTGGTGGGG + Intronic
1048335047 8:133496523-133496545 CTGTGTGTTCCTCTGTGATCTGG - Intronic
1048457998 8:134595504-134595526 CCGTATCTGTCTCTGTGATCTGG - Intronic
1049092501 8:140526863-140526885 CCGTGTGTCACTCTGTGGTCAGG - Intergenic
1049603689 8:143519510-143519532 CCGTTTCTGCGGCTGTGATGTGG - Intronic
1049620168 8:143594577-143594599 CTGTGTGTGCGACTGTGATGGGG - Intronic
1050464795 9:5910782-5910804 GTGTGGGTGCCTCTGTGAAGTGG - Intronic
1053017150 9:34668409-34668431 ATGTGTGTGCCTGTGTGGTGTGG - Intergenic
1054254357 9:62799422-62799444 CCGTGTGTGTCTGTGTGTTTGGG - Intergenic
1054336941 9:63816173-63816195 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
1056654646 9:88499135-88499157 CTGTGTGTGCCTGTGTTCTGTGG - Intergenic
1056893505 9:90518089-90518111 CCGTGGGTGCCACTGGGATTTGG + Intergenic
1057140707 9:92725279-92725301 CTGGGTGTGCCTCTGTGTTCTGG - Intronic
1059313935 9:113408418-113408440 CCTTGGCTGCCTCTGTGATCTGG + Exonic
1061886386 9:133593049-133593071 CCGTGTGCGCCTGTGCGGTGCGG + Intergenic
1061972609 9:134053101-134053123 CCCTGTGCGCCTCTGTGCTGTGG + Intronic
1062284841 9:135768319-135768341 CCGTGGGGGACACTGTGATGTGG + Intronic
1062650652 9:137575167-137575189 CTGTGTGTGCCACTGTGGTCTGG - Intronic
1203372515 Un_KI270442v1:321838-321860 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
1203634250 Un_KI270750v1:96300-96322 CCGTGGGAACCACTGTGATGGGG + Intergenic
1185650201 X:1642091-1642113 CTGTGTGTGTGTGTGTGATGGGG + Intronic
1185969516 X:4646879-4646901 CTGTGTCTCCCTCTGAGATGTGG + Intergenic
1187107125 X:16254782-16254804 CTGTGTGTGCCTAGGGGATGGGG - Intergenic
1187237768 X:17484473-17484495 CCGTGTGGGCCCCCATGATGTGG - Intronic
1187240181 X:17505851-17505873 ATGTGTGTGCTTCTGTAATGGGG + Intronic
1189187659 X:39068089-39068111 CTGTCTGTGCCACTGTGATCTGG - Intergenic
1198611112 X:138401604-138401626 ACGTGTGTGTCTCAGTGTTGGGG - Intergenic
1199182722 X:144878011-144878033 TAGTGTGTGCCTCTCTCATGGGG + Intergenic
1199786972 X:151114515-151114537 CGGTGTGTGCCTTTGCAATGGGG + Intergenic
1201064869 Y:10088331-10088353 CCGTGTGTGTCTGTGTGTTTGGG - Intergenic
1202282201 Y:23201158-23201180 CCTTGTGTGACAGTGTGATGTGG + Intergenic
1202283690 Y:23217361-23217383 CCTTGTGTGACAGTGTGATGTGG - Intergenic
1202433873 Y:24815543-24815565 CCTTGTGTGACAGTGTGATGTGG + Intergenic
1202435366 Y:24831747-24831769 CCTTGTGTGACAGTGTGATGTGG - Intergenic