ID: 1037814103

View in Genome Browser
Species Human (GRCh38)
Location 8:22102881-22102903
Sequence ACGTTCTGGCGAGGATCATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 83}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037814103_1037814109 0 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814109 8:22102904-22102926 CTCCCCAGCCCCGGAAGGGCAGG 0: 1
1: 0
2: 2
3: 28
4: 367
1037814103_1037814120 25 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814120 8:22102929-22102951 TGAGCCAGCACCAGGGCGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 163
1037814103_1037814107 -5 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814107 8:22102899-22102921 AACGTCTCCCCAGCCCCGGAAGG 0: 1
1: 0
2: 2
3: 7
4: 92
1037814103_1037814119 24 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814119 8:22102928-22102950 CTGAGCCAGCACCAGGGCGGTGG 0: 1
1: 0
2: 4
3: 31
4: 313
1037814103_1037814118 21 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814103_1037814106 -9 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814106 8:22102895-22102917 CCAGAACGTCTCCCCAGCCCCGG 0: 1
1: 0
2: 3
3: 23
4: 224
1037814103_1037814117 18 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814117 8:22102922-22102944 GCAGGTCTGAGCCAGCACCAGGG 0: 1
1: 0
2: 2
3: 28
4: 351
1037814103_1037814116 17 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814103_1037814108 -4 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814108 8:22102900-22102922 ACGTCTCCCCAGCCCCGGAAGGG 0: 1
1: 0
2: 1
3: 30
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037814103 Original CRISPR ACGTTCTGGCGAGGATCATG TGG (reversed) Exonic