ID: 1037814104

View in Genome Browser
Species Human (GRCh38)
Location 8:22102890-22102912
Sequence GCTGGGGAGACGTTCTGGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037814104_1037814116 8 Left 1037814104 8:22102890-22102912 CCTCGCCAGAACGTCTCCCCAGC 0: 1
1: 0
2: 2
3: 11
4: 99
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814104_1037814119 15 Left 1037814104 8:22102890-22102912 CCTCGCCAGAACGTCTCCCCAGC 0: 1
1: 0
2: 2
3: 11
4: 99
Right 1037814119 8:22102928-22102950 CTGAGCCAGCACCAGGGCGGTGG 0: 1
1: 0
2: 4
3: 31
4: 313
1037814104_1037814117 9 Left 1037814104 8:22102890-22102912 CCTCGCCAGAACGTCTCCCCAGC 0: 1
1: 0
2: 2
3: 11
4: 99
Right 1037814117 8:22102922-22102944 GCAGGTCTGAGCCAGCACCAGGG 0: 1
1: 0
2: 2
3: 28
4: 351
1037814104_1037814120 16 Left 1037814104 8:22102890-22102912 CCTCGCCAGAACGTCTCCCCAGC 0: 1
1: 0
2: 2
3: 11
4: 99
Right 1037814120 8:22102929-22102951 TGAGCCAGCACCAGGGCGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 163
1037814104_1037814118 12 Left 1037814104 8:22102890-22102912 CCTCGCCAGAACGTCTCCCCAGC 0: 1
1: 0
2: 2
3: 11
4: 99
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814104_1037814109 -9 Left 1037814104 8:22102890-22102912 CCTCGCCAGAACGTCTCCCCAGC 0: 1
1: 0
2: 2
3: 11
4: 99
Right 1037814109 8:22102904-22102926 CTCCCCAGCCCCGGAAGGGCAGG 0: 1
1: 0
2: 2
3: 28
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037814104 Original CRISPR GCTGGGGAGACGTTCTGGCG AGG (reversed) Exonic