ID: 1037814110

View in Genome Browser
Species Human (GRCh38)
Location 8:22102906-22102928
Sequence GACCTGCCCTTCCGGGGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037814110_1037814117 -7 Left 1037814110 8:22102906-22102928 CCCCAGCCCCGGAAGGGCAGGTC 0: 1
1: 0
2: 2
3: 22
4: 274
Right 1037814117 8:22102922-22102944 GCAGGTCTGAGCCAGCACCAGGG 0: 1
1: 0
2: 2
3: 28
4: 351
1037814110_1037814120 0 Left 1037814110 8:22102906-22102928 CCCCAGCCCCGGAAGGGCAGGTC 0: 1
1: 0
2: 2
3: 22
4: 274
Right 1037814120 8:22102929-22102951 TGAGCCAGCACCAGGGCGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 163
1037814110_1037814119 -1 Left 1037814110 8:22102906-22102928 CCCCAGCCCCGGAAGGGCAGGTC 0: 1
1: 0
2: 2
3: 22
4: 274
Right 1037814119 8:22102928-22102950 CTGAGCCAGCACCAGGGCGGTGG 0: 1
1: 0
2: 4
3: 31
4: 313
1037814110_1037814118 -4 Left 1037814110 8:22102906-22102928 CCCCAGCCCCGGAAGGGCAGGTC 0: 1
1: 0
2: 2
3: 22
4: 274
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814110_1037814116 -8 Left 1037814110 8:22102906-22102928 CCCCAGCCCCGGAAGGGCAGGTC 0: 1
1: 0
2: 2
3: 22
4: 274
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037814110 Original CRISPR GACCTGCCCTTCCGGGGCTG GGG (reversed) Exonic