ID: 1037814112

View in Genome Browser
Species Human (GRCh38)
Location 8:22102908-22102930
Sequence CAGACCTGCCCTTCCGGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037814112_1037814118 -6 Left 1037814112 8:22102908-22102930 CCAGCCCCGGAAGGGCAGGTCTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814112_1037814117 -9 Left 1037814112 8:22102908-22102930 CCAGCCCCGGAAGGGCAGGTCTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1037814117 8:22102922-22102944 GCAGGTCTGAGCCAGCACCAGGG 0: 1
1: 0
2: 2
3: 28
4: 351
1037814112_1037814116 -10 Left 1037814112 8:22102908-22102930 CCAGCCCCGGAAGGGCAGGTCTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814112_1037814119 -3 Left 1037814112 8:22102908-22102930 CCAGCCCCGGAAGGGCAGGTCTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1037814119 8:22102928-22102950 CTGAGCCAGCACCAGGGCGGTGG 0: 1
1: 0
2: 4
3: 31
4: 313
1037814112_1037814120 -2 Left 1037814112 8:22102908-22102930 CCAGCCCCGGAAGGGCAGGTCTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1037814120 8:22102929-22102951 TGAGCCAGCACCAGGGCGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037814112 Original CRISPR CAGACCTGCCCTTCCGGGGC TGG (reversed) Exonic