ID: 1037814113

View in Genome Browser
Species Human (GRCh38)
Location 8:22102912-22102934
Sequence GGCTCAGACCTGCCCTTCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037814113_1037814118 -10 Left 1037814113 8:22102912-22102934 CCCCGGAAGGGCAGGTCTGAGCC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814113_1037814119 -7 Left 1037814113 8:22102912-22102934 CCCCGGAAGGGCAGGTCTGAGCC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1037814119 8:22102928-22102950 CTGAGCCAGCACCAGGGCGGTGG 0: 1
1: 0
2: 4
3: 31
4: 313
1037814113_1037814120 -6 Left 1037814113 8:22102912-22102934 CCCCGGAAGGGCAGGTCTGAGCC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1037814120 8:22102929-22102951 TGAGCCAGCACCAGGGCGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037814113 Original CRISPR GGCTCAGACCTGCCCTTCCG GGG (reversed) Exonic