ID: 1037814116

View in Genome Browser
Species Human (GRCh38)
Location 8:22102921-22102943
Sequence GGCAGGTCTGAGCCAGCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 348}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037814112_1037814116 -10 Left 1037814112 8:22102908-22102930 CCAGCCCCGGAAGGGCAGGTCTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814110_1037814116 -8 Left 1037814110 8:22102906-22102928 CCCCAGCCCCGGAAGGGCAGGTC 0: 1
1: 0
2: 2
3: 22
4: 274
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814102_1037814116 18 Left 1037814102 8:22102880-22102902 CCCACATGATCCTCGCCAGAACG 0: 1
1: 0
2: 0
3: 6
4: 38
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814100_1037814116 20 Left 1037814100 8:22102878-22102900 CCCCCACATGATCCTCGCCAGAA 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814104_1037814116 8 Left 1037814104 8:22102890-22102912 CCTCGCCAGAACGTCTCCCCAGC 0: 1
1: 0
2: 2
3: 11
4: 99
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814101_1037814116 19 Left 1037814101 8:22102879-22102901 CCCCACATGATCCTCGCCAGAAC 0: 1
1: 0
2: 1
3: 4
4: 79
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814103_1037814116 17 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814105_1037814116 3 Left 1037814105 8:22102895-22102917 CCAGAACGTCTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1037814111_1037814116 -9 Left 1037814111 8:22102907-22102929 CCCAGCCCCGGAAGGGCAGGTCT 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1037814116 8:22102921-22102943 GGCAGGTCTGAGCCAGCACCAGG 0: 1
1: 0
2: 3
3: 33
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037814116 Original CRISPR GGCAGGTCTGAGCCAGCACC AGG Exonic