ID: 1037814118

View in Genome Browser
Species Human (GRCh38)
Location 8:22102925-22102947
Sequence GGTCTGAGCCAGCACCAGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 239}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037814113_1037814118 -10 Left 1037814113 8:22102912-22102934 CCCCGGAAGGGCAGGTCTGAGCC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814111_1037814118 -5 Left 1037814111 8:22102907-22102929 CCCAGCCCCGGAAGGGCAGGTCT 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814104_1037814118 12 Left 1037814104 8:22102890-22102912 CCTCGCCAGAACGTCTCCCCAGC 0: 1
1: 0
2: 2
3: 11
4: 99
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814103_1037814118 21 Left 1037814103 8:22102881-22102903 CCACATGATCCTCGCCAGAACGT 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814112_1037814118 -6 Left 1037814112 8:22102908-22102930 CCAGCCCCGGAAGGGCAGGTCTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814101_1037814118 23 Left 1037814101 8:22102879-22102901 CCCCACATGATCCTCGCCAGAAC 0: 1
1: 0
2: 1
3: 4
4: 79
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814100_1037814118 24 Left 1037814100 8:22102878-22102900 CCCCCACATGATCCTCGCCAGAA 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814110_1037814118 -4 Left 1037814110 8:22102906-22102928 CCCCAGCCCCGGAAGGGCAGGTC 0: 1
1: 0
2: 2
3: 22
4: 274
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814105_1037814118 7 Left 1037814105 8:22102895-22102917 CCAGAACGTCTCCCCAGCCCCGG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239
1037814102_1037814118 22 Left 1037814102 8:22102880-22102902 CCCACATGATCCTCGCCAGAACG 0: 1
1: 0
2: 0
3: 6
4: 38
Right 1037814118 8:22102925-22102947 GGTCTGAGCCAGCACCAGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037814118 Original CRISPR GGTCTGAGCCAGCACCAGGG CGG Exonic