ID: 1037814489

View in Genome Browser
Species Human (GRCh38)
Location 8:22104627-22104649
Sequence CCACCCCGGAGACACCATGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037814482_1037814489 14 Left 1037814482 8:22104590-22104612 CCACTTCTGCTGGGCTGACCTGC 0: 1
1: 0
2: 1
3: 24
4: 288
Right 1037814489 8:22104627-22104649 CCACCCCGGAGACACCATGAGGG 0: 1
1: 0
2: 0
3: 8
4: 131
1037814484_1037814489 -4 Left 1037814484 8:22104608-22104630 CCTGCAGCGGAGAGTCTGCCCAC 0: 1
1: 0
2: 1
3: 8
4: 103
Right 1037814489 8:22104627-22104649 CCACCCCGGAGACACCATGAGGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037814489 Original CRISPR CCACCCCGGAGACACCATGA GGG Exonic
900098053 1:948363-948385 CCAGCCCTGGGAGACCATGAAGG + Intronic
900572169 1:3364015-3364037 CCCCCCCGCAGACAAAATGAGGG - Intronic
901064983 1:6490233-6490255 CCACCCTAGAGACACTGTGATGG + Intronic
901334211 1:8434773-8434795 CCACGCTGGAGAGACCATCAGGG + Intronic
910280404 1:85494459-85494481 CCACCCAGGAGACAGCAGGAGGG + Intronic
911518744 1:98902632-98902654 CCATCCTGGAGACACTATGGAGG - Intronic
914745371 1:150497541-150497563 TCACCTCGGAGAAACCACGATGG - Exonic
918180599 1:182083568-182083590 ACAGCCCGGAGACAGCAGGAGGG - Intergenic
920697203 1:208190041-208190063 CCACACCGAAGTCACCCTGAAGG + Intronic
1063459215 10:6204523-6204545 CCACCCAGGGCACACCATGGGGG - Intronic
1063979839 10:11444504-11444526 CTATCCCGAAGACACCATGCTGG + Intergenic
1065496354 10:26332728-26332750 CCAGCCAGGAGAGACCAGGACGG + Intergenic
1066428141 10:35327848-35327870 CCAGCCAGGAGCCACCATGGAGG - Intronic
1066758802 10:38736367-38736389 CACCCCTGGAGACACCATGGGGG + Intergenic
1070872973 10:79774067-79774089 CCACACCTGAGATACCAGGAGGG + Intergenic
1073336341 10:102713662-102713684 CCGCCACGCAGACACCAAGACGG + Intronic
1076132114 10:128020681-128020703 CCACCACTGGGACACCAGGAGGG - Intronic
1081816858 11:45950228-45950250 CAACCCTAGAGACACCATGAAGG + Exonic
1083365632 11:62140097-62140119 CCACCCCGGAGCTGCCAGGAAGG + Intronic
1083692771 11:64420448-64420470 CCTCCCAGGAGTCAACATGATGG - Intergenic
1085531867 11:77196720-77196742 CCACCCATGAGAGCCCATGAGGG - Intronic
1090075383 11:123577448-123577470 CCAGGACGGAGACACCATGGTGG + Exonic
1092254144 12:6917031-6917053 CCACCACAGAGAGACCCTGAGGG - Exonic
1096911718 12:54990735-54990757 CAACCTTGGAGAAACCATGAAGG + Intergenic
1102633486 12:114302269-114302291 CCACCCTGGAGGCACCAGGAGGG - Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104906196 12:132214678-132214700 CCACCCAGGAGGCACCAGGCTGG - Intronic
1105074571 12:133264414-133264436 AGACCCAGGAGACACCACGAAGG + Intergenic
1111323363 13:86659697-86659719 ACACCTCCGAGACACCAGGATGG - Intergenic
1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG + Intergenic
1122692192 14:103536670-103536692 CCACCCATCAGACACCATGCAGG - Exonic
1122860260 14:104579362-104579384 CCACCACGGAGGCCCCATGCTGG + Intronic
1202909012 14_GL000194v1_random:100205-100227 ACTCCCCTGAGACCCCATGATGG + Intergenic
1202884246 14_KI270722v1_random:89024-89046 ACTCCCCTGAGACCCCATGATGG - Intergenic
1125309717 15:38365514-38365536 CCACTCAGGAGACAACAGGAAGG - Intergenic
1129706102 15:77795481-77795503 CCACACCAGAGACAGCGTGAGGG - Intronic
1130959576 15:88650740-88650762 CCACCCCAAAGCCACCATGCTGG - Intronic
1131484772 15:92810612-92810634 CCAGCCCGAAGAAACCATAAGGG - Intergenic
1134553618 16:15149929-15149951 CCACGGAGGAGACACCATGGAGG + Intergenic
1139589992 16:67928229-67928251 GCTCCCTGGAGGCACCATGAAGG - Exonic
1141622126 16:85241908-85241930 CCTCCCGGCAGCCACCATGAAGG - Intergenic
1142042035 16:87900376-87900398 CCACCCCGAAGCCAGCATCAAGG + Intronic
1142848086 17:2691746-2691768 CCGCCCCGGACTCACCTTGAGGG + Exonic
1143998270 17:11027993-11028015 CCAACCCAGAAACACCGTGAAGG + Intergenic
1149453942 17:56772036-56772058 CCTCCCCGGGGACACAAGGACGG - Intergenic
1151702734 17:75752096-75752118 CCACCCCTGACACAGCAGGACGG - Intronic
1152574537 17:81134254-81134276 CCACCCAGCAGCCACCTTGATGG + Intronic
1152803708 17:82344569-82344591 CCACCCCGCACCCACCAGGAGGG - Intergenic
1154359546 18:13647915-13647937 CAACCCTGGAGACACCCTGAAGG + Exonic
1158556253 18:58477171-58477193 CCACCCTGCAGGCACCAGGAAGG + Intergenic
1160568999 18:79803868-79803890 CAACCCCGGAGAAACCAACACGG - Intergenic
1162156103 19:8678987-8679009 CCCCCCAGGGGACACCAAGAAGG - Intergenic
1162762473 19:12896860-12896882 CCACCCAAGAGACACCAAGAGGG - Intronic
1164501476 19:28823882-28823904 ACACCCCGGGGAGACCCTGAAGG + Intergenic
1164872708 19:31659522-31659544 CCACCCTGGAGATGCCATGTAGG + Intergenic
1164942986 19:32266022-32266044 CCAGCTCAGAAACACCATGAGGG + Intergenic
1202659663 1_KI270708v1_random:56154-56176 ACTCCCCTGAGACCCCATGATGG - Intergenic
929581326 2:43083293-43083315 CCACCCGACAGACACCTTGAGGG + Intergenic
933178669 2:79205198-79205220 CTACCCTGAAGACACCATGCTGG + Intronic
935609487 2:105006203-105006225 CCACCCTGCTGACACCTTGATGG - Intergenic
938553416 2:132401523-132401545 CCATACTGGAGACACCATGCAGG - Intergenic
948868172 2:240785675-240785697 CCAGCACGGAGTCACAATGACGG + Intronic
1174162283 20:48560058-48560080 CCATCAAGGAAACACCATGAAGG - Intergenic
1175358744 20:58390203-58390225 GCAACCAGGAGACAGCATGAGGG - Intronic
1175757416 20:61538560-61538582 CCACCCAGGAGGCACCAGCAGGG - Intronic
1175950295 20:62580093-62580115 CCACCCAGGAGAGCCCCTGAAGG - Intergenic
1176288826 21:5033780-5033802 CCACTCCGGACACCCCATGGGGG - Intronic
1176288879 21:5033909-5033931 CCACTCCGGACACCCCATGGGGG - Intronic
1176628372 21:9114917-9114939 ACTCCCCTGAGACCCCATGATGG + Intergenic
1179531029 21:42019844-42019866 CAAGCACGGAGACTCCATGAGGG - Intergenic
1179717106 21:43294393-43294415 CCACCCAGGAGAGACCCTGCAGG - Intergenic
1179868356 21:44229695-44229717 CCACTCCGGACACCCCATGGGGG + Intronic
1180123305 21:45768452-45768474 ACACCCCTAAGACACCATGACGG - Intronic
1180159991 21:45994775-45994797 CCACACTGGAGCCACCATCATGG - Intronic
1180327132 22:11439716-11439738 ACTCCCCTGAGACCCCATGATGG - Intergenic
1183185976 22:36291875-36291897 CCTCCCCGGCGAGACCCTGAGGG + Intronic
1183671240 22:39274165-39274187 CCCCACCGCAGACCCCATGAGGG + Intergenic
1184790856 22:46699064-46699086 CCACAGAGTAGACACCATGACGG - Intronic
1185087519 22:48748874-48748896 CCGCCCAGGAGACAGCATCAGGG + Intronic
950641437 3:14351129-14351151 CCACACCTGCTACACCATGATGG - Intergenic
954638843 3:52086103-52086125 CCACCAGGGAGACATCATGGGGG - Intronic
955032434 3:55233921-55233943 AGTCCCCGGAGACACCCTGAGGG - Intergenic
955187565 3:56729774-56729796 CCACCCTGCAGCCACCATCAGGG + Intronic
967948563 3:194823132-194823154 CTGCCACGGAGACACAATGATGG - Intergenic
968611610 4:1559776-1559798 CCACCCCGCAGGCACCACGCAGG - Intergenic
968912615 4:3483821-3483843 CCAGCCAGCAGACAGCATGACGG + Intronic
971394848 4:26218370-26218392 CTCCCCAGGAGACACCCTGATGG + Intronic
973172820 4:47166343-47166365 CCACCCCTGAGACAGCAAGAAGG + Intronic
975023351 4:69518383-69518405 CCACTTCTCAGACACCATGATGG + Intronic
979448492 4:120840742-120840764 CCAGCCCGGACACATCATGGTGG + Intronic
986667241 5:10114365-10114387 GCTCCCAGGAGACACCAAGAGGG - Intergenic
986801513 5:11265399-11265421 GCACACAGGAGAAACCATGAGGG + Intronic
987383009 5:17303390-17303412 CCACACCAGAGACACCAAAAAGG - Intergenic
988922424 5:35955781-35955803 CCACCATGGGCACACCATGACGG + Exonic
995403929 5:111772637-111772659 CCTCCCCCGAGACACCAACAGGG + Intronic
995478648 5:112573213-112573235 CCACTTGGGAGACACCCTGAAGG - Intergenic
1001324714 5:170714061-170714083 CCAAATCAGAGACACCATGAGGG + Intronic
1004602400 6:17162967-17162989 CCTCCCCAGAAACACCACGATGG + Intergenic
1005389481 6:25318692-25318714 CCACCCGGGAGACCCCACGTGGG + Intronic
1005842811 6:29755307-29755329 TCAACCCAAAGACACCATGACGG - Intergenic
1016107027 6:140175561-140175583 CCACCTCACAGTCACCATGATGG - Intergenic
1019070080 6:169338284-169338306 CCAGCCAGGAGAGACCAGGATGG - Intergenic
1019514084 7:1432167-1432189 AGACCCCGGTGACACCATCATGG - Intronic
1024521441 7:50308232-50308254 CCACCAAGGAGACACCAAAATGG - Intronic
1024527630 7:50362260-50362282 TCATCCCTGAAACACCATGAGGG + Intronic
1028921504 7:96315128-96315150 GCACCCTGGAGACACCAGGCAGG + Intronic
1029436473 7:100566721-100566743 CCACCCAGGAGACAGAAGGAGGG - Exonic
1029598860 7:101552115-101552137 CAACACAGGAGACACAATGATGG + Intronic
1032703072 7:134398940-134398962 CCACCCCCCAGCCACCAAGACGG + Intergenic
1035287848 7:157817480-157817502 CCACCCCAGAGCCACCATCACGG + Intronic
1035443032 7:158919842-158919864 ACACCCAGCAGACACCAAGAAGG + Intronic
1035496850 7:159335410-159335432 AGACCCAGGAGACACCACGAAGG + Intergenic
1035868090 8:3106597-3106619 CCACCCCGGGTACACCTTGGTGG - Exonic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037814489 8:22104627-22104649 CCACCCCGGAGACACCATGAGGG + Exonic
1037827562 8:22168387-22168409 CCCCCCCGGAGAGACCTTGGAGG + Intronic
1038431946 8:27507445-27507467 CAACCCCAGGGACATCATGATGG - Intronic
1044930159 8:97244572-97244594 CCACTTCAGAGACACCAGGAAGG - Intergenic
1045389999 8:101705724-101705746 CCACCCCAAAGCCACCATGGAGG + Intronic
1053643556 9:40108739-40108761 ACACCCGGGAGACACCGCGAAGG + Intergenic
1053752955 9:41274276-41274298 ACACCCGGGAGACACCGCGAAGG + Intergenic
1053762595 9:41356751-41356773 ACACCCGGGAGACACCGCGAAGG - Intergenic
1054541196 9:66267865-66267887 ACACCCGGGAGACACCGCGAAGG - Intergenic
1056873244 9:90304504-90304526 CCACCCTGGAGCCACCAGGCAGG + Intergenic
1060794184 9:126503557-126503579 TCACCACGGAGTCACCCTGAGGG + Exonic
1061895232 9:133643607-133643629 CCAGGCAGGAGACACCATGCTGG - Intronic
1061907602 9:133706860-133706882 CCACCCCCGAGGCCCCAAGAAGG + Intronic
1062383924 9:136301068-136301090 CCACCCAGGGCACAGCATGAAGG - Intronic
1203751217 Un_GL000218v1:82600-82622 ACTCCCCTGAGACCCCATGATGG + Intergenic
1203482769 Un_GL000224v1:21754-21776 ACTCCCCTGAGACCCCATGATGG - Intergenic
1191659364 X:63634420-63634442 ACATCCAGGTGACACCATGATGG + Intergenic
1191899039 X:66022457-66022479 CGACTCTGGAGAAACCATGAGGG - Exonic
1193161439 X:78233282-78233304 CCACCCAAGAGAAGCCATGAGGG - Intergenic
1201164870 Y:11200208-11200230 ACTCCCCTGAGACCCCATGATGG + Intergenic
1202119245 Y:21507670-21507692 CCTCCCTGGACACACAATGAAGG + Intergenic
1202121697 Y:21531210-21531232 CCTCCCTGGACACACAATGAAGG + Intronic
1202157308 Y:21898172-21898194 CCTCCCTGGACACACAATGAAGG - Intronic
1202159755 Y:21921713-21921735 CCTCCCTGGACACACAATGAAGG - Intergenic
1202186198 Y:22186628-22186650 CCTCCCTGGACACACAATGAAGG - Intergenic
1202205161 Y:22399768-22399790 CCTCCCTGGACACACAATGAAGG + Intronic