ID: 1037819454

View in Genome Browser
Species Human (GRCh38)
Location 8:22128714-22128736
Sequence CCTTCTGGAGACCAAGATCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037819454_1037819464 10 Left 1037819454 8:22128714-22128736 CCAGGATCTTGGTCTCCAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 183
Right 1037819464 8:22128747-22128769 GCCAGGGCCGGAAGGCCACAGGG 0: 1
1: 0
2: 1
3: 20
4: 341
1037819454_1037819468 25 Left 1037819454 8:22128714-22128736 CCAGGATCTTGGTCTCCAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 183
Right 1037819468 8:22128762-22128784 CCACAGGGTCACTCTTGAGATGG 0: 1
1: 0
2: 1
3: 15
4: 135
1037819454_1037819460 -6 Left 1037819454 8:22128714-22128736 CCAGGATCTTGGTCTCCAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 183
Right 1037819460 8:22128731-22128753 AGAAGGAAAGGGCAGTGCCAGGG 0: 1
1: 0
2: 3
3: 58
4: 686
1037819454_1037819463 9 Left 1037819454 8:22128714-22128736 CCAGGATCTTGGTCTCCAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 183
Right 1037819463 8:22128746-22128768 TGCCAGGGCCGGAAGGCCACAGG 0: 1
1: 0
2: 0
3: 10
4: 185
1037819454_1037819461 -2 Left 1037819454 8:22128714-22128736 CCAGGATCTTGGTCTCCAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 183
Right 1037819461 8:22128735-22128757 GGAAAGGGCAGTGCCAGGGCCGG 0: 1
1: 1
2: 7
3: 133
4: 1088
1037819454_1037819462 2 Left 1037819454 8:22128714-22128736 CCAGGATCTTGGTCTCCAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 183
Right 1037819462 8:22128739-22128761 AGGGCAGTGCCAGGGCCGGAAGG 0: 1
1: 1
2: 1
3: 92
4: 431
1037819454_1037819459 -7 Left 1037819454 8:22128714-22128736 CCAGGATCTTGGTCTCCAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 183
Right 1037819459 8:22128730-22128752 CAGAAGGAAAGGGCAGTGCCAGG 0: 1
1: 1
2: 0
3: 51
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037819454 Original CRISPR CCTTCTGGAGACCAAGATCC TGG (reversed) Exonic
900092952 1:928447-928469 CCTTCTGCAGCCCAAGCACCAGG - Intronic
902980071 1:20116153-20116175 CCTTCTGGAAGGCAAGCTCCAGG + Intronic
909595899 1:77405816-77405838 CCTTCTGGAGACCATGTTGCCGG + Intronic
910615637 1:89195311-89195333 CCTTCTGGACACCGAGGGCCTGG - Exonic
911294946 1:96103566-96103588 CCATCTGCAGACCAGGATACGGG + Intergenic
911327429 1:96484630-96484652 CCTTCTGGTGACAAAGATTGAGG - Intergenic
913256627 1:116960175-116960197 CCTTCTGGGGACCCAGGACCAGG + Intronic
915380299 1:155433972-155433994 CCTTCTCGAGCCCAAGCTGCTGG - Intronic
917176320 1:172239611-172239633 GCTTCTGGAGACAAAGACCATGG - Intronic
920030293 1:203033663-203033685 CCTTCTTGAGAGCAAGATGGGGG - Intronic
920246048 1:204588579-204588601 CCTTCTGGGGATCAATAGCCTGG + Intergenic
920733685 1:208512185-208512207 CCTTCTGGGGTCCCAGATCCTGG + Intergenic
921046620 1:211482347-211482369 TCTCCTGGAGAGCAGGATCCTGG - Intronic
922930784 1:229387657-229387679 AGTTCTGGAGGCCAAGATCAAGG + Intergenic
923233711 1:232012364-232012386 CCTTCTGTAGTCTAAAATCCTGG - Intronic
923511590 1:234658184-234658206 CCTTCTGGGGAGGAATATCCAGG + Intergenic
924299068 1:242618662-242618684 CCTTCCGGAGCCCAAGCCCCAGG + Intergenic
1066010360 10:31188678-31188700 GCTTCTGGAGCCCAAGTTCTGGG - Intergenic
1066477067 10:35757752-35757774 CCTTGTGCAGAGCAAGATCTGGG + Intergenic
1069397993 10:68010480-68010502 CCTTCTAGAGCCCAAGCTGCTGG + Intronic
1073026620 10:100491986-100492008 GGTTCTGGAGTCCAAGATCAAGG - Intronic
1073542841 10:104326957-104326979 AGTTCTGGAGACCAGGATCAAGG - Intronic
1074056512 10:109926989-109927011 CCTTCTGCCAGCCAAGATCCTGG + Intergenic
1074497432 10:113992326-113992348 ACTTCAGGAGACCGAGGTCCTGG + Intergenic
1076164010 10:128267875-128267897 CCTTCTGGAGTCCAAGGTGGGGG + Intergenic
1076306348 10:129467728-129467750 CCTGCTGGAGGCCAAGTTCTAGG + Intronic
1077544394 11:3162973-3162995 CCTTGTGGAGTCCAAGGGCCAGG - Intronic
1078909100 11:15714230-15714252 CTTTCTGCAGACCAAGATCTTGG + Intergenic
1079115698 11:17639306-17639328 TCTTCTGAAGACCCAGCTCCAGG - Intronic
1079133009 11:17760513-17760535 CCTTCTGGGGACTAACATTCAGG + Intronic
1079181445 11:18197237-18197259 CCTTCTGGAGAACCAGCTTCAGG - Intronic
1079326619 11:19498301-19498323 CCTTTTGGGGACCAACCTCCTGG - Intronic
1084013684 11:66366499-66366521 CCTTCTCCAGGTCAAGATCCAGG + Exonic
1094252728 12:28383605-28383627 GCTGCGGGAGACCATGATCCTGG + Intronic
1096212458 12:49777015-49777037 CCTGCAGGAGACCAAGAAGCTGG - Intergenic
1103168431 12:118791159-118791181 TCTTCTGCAGACCAAGGTCTAGG + Intergenic
1103200158 12:119081650-119081672 CCTTCTGGGGAACAGGATGCAGG + Intronic
1104698633 12:130883837-130883859 GCTTCTGGAGATCAAAAGCCTGG - Intergenic
1105323393 13:19347964-19347986 CCTTCTGGTGGCCAACACCCTGG + Intergenic
1105873995 13:24537873-24537895 CCTTCTGGTGGCCAACACCCTGG - Intergenic
1107217048 13:37934292-37934314 CCATCTGGAGACCAGGACACTGG + Intergenic
1107450764 13:40507071-40507093 CCTACAGGAGACCAAGGTCCAGG - Intergenic
1108519920 13:51237544-51237566 CCTTATGGAGAACCCGATCCAGG - Intronic
1113804611 13:113106053-113106075 CCTTCTAGAAACCAGCATCCAGG + Intronic
1114455690 14:22851918-22851940 CATTCTGGAGTCCAAGATGACGG + Intergenic
1116019355 14:39441914-39441936 CCTTCTGGGGACCCAGACCTTGG + Intergenic
1117413077 14:55468229-55468251 CCTTCTGGGGACCCAGACCTAGG - Intergenic
1119665601 14:76482845-76482867 CCTTCTGGGGTCCAGGATCCGGG - Intronic
1119944092 14:78673641-78673663 CCATCTGCAGACCAAGAAGCAGG - Intronic
1121220200 14:92279244-92279266 CCCTCTGCAGAGCAAGCTCCTGG + Intergenic
1121408579 14:93734158-93734180 CCATCTGCAGACCAAGACCTGGG - Intronic
1123982118 15:25613691-25613713 CCTTTCAGAGACAAAGATCCGGG + Intergenic
1126220878 15:46211340-46211362 CCATCTGGAGACCATCATTCTGG + Intergenic
1127393982 15:58528926-58528948 ACTGCTGGAGACAAGGATCCTGG - Intronic
1130643339 15:85700423-85700445 GCCTCTGGAGAGCAAGATCTGGG + Intronic
1130964351 15:88686003-88686025 CCTCCTGGATCCCAAGATGCTGG - Intergenic
1131296691 15:91155516-91155538 TCTTCTGGACCCCAAGATGCAGG + Intronic
1131696475 15:94882410-94882432 CCTTCTGGAGGCCCAGACCTCGG - Intergenic
1132233916 15:100205145-100205167 CCTCCTGAAGTCCAGGATCCTGG - Intronic
1133267619 16:4594372-4594394 CCTCCTGGATACCGAGGTCCTGG - Exonic
1133312700 16:4860563-4860585 TCTCCTGGAGACCATGACCCTGG + Intronic
1134071650 16:11263863-11263885 CCTGCTGGAGACCCAAATTCAGG - Intronic
1136284736 16:29234092-29234114 CAGCCTGGAGACCAAAATCCAGG + Intergenic
1136658610 16:31732186-31732208 CCAGCTGGAGCCCAAGATCAAGG - Intronic
1136925185 16:34365574-34365596 CCCTCTGAAGGCCAGGATCCAGG - Intergenic
1136979388 16:35046232-35046254 CCCTCTGAAGGCCAGGATCCAGG + Intergenic
1137393479 16:48100683-48100705 TCTTCTGGGGCCCAAGATGCTGG + Intronic
1138585466 16:57967220-57967242 CCCTCGGAAGACCAAGATGCAGG - Exonic
1138992603 16:62409643-62409665 CCTTCTGGAGGCCCAGACCTTGG - Intergenic
1139279150 16:65754832-65754854 CCTTCTGCAAACCAAGAAGCGGG + Intergenic
1140698426 16:77558660-77558682 CCTTCTCTAGGCCAAGATCTTGG - Intergenic
1141476779 16:84279374-84279396 CCTCCTGCAGCCCTAGATCCTGG + Intergenic
1142089755 16:88203560-88203582 CAGCCTGGAGACCAAAATCCAGG + Intergenic
1143147352 17:4785427-4785449 CGGCCTGCAGACCAAGATCCAGG - Exonic
1143335246 17:6167231-6167253 CCATCTGGAGACTAAGAGTCAGG + Intergenic
1144501312 17:15787948-15787970 TCTTCTGGGGACCAAGGCCCAGG - Intergenic
1144762301 17:17714210-17714232 CCTTCTGCAGACCCAGAAACTGG - Intronic
1145163486 17:20590622-20590644 TCTTCTGGGGACCAAGGCCCAGG - Intergenic
1146002242 17:29138371-29138393 CCTTCTGAGGACCAAGAGGCAGG + Intronic
1147187650 17:38721602-38721624 CCATCTGGTGAACCAGATCCTGG - Intronic
1148209175 17:45797972-45797994 CCTTCTGGAGTCCAAGGTGCGGG + Intronic
1148838960 17:50482524-50482546 CCTTCTGAAGAGAAGGATCCTGG + Intronic
1150283502 17:63943084-63943106 CATGCTGCAGAACAAGATCCAGG - Exonic
1151354792 17:73551857-73551879 CCATCTGGAGACCCAACTCCAGG + Intronic
1151552717 17:74831272-74831294 CCTTCTGGAGCCCAGAGTCCAGG - Intronic
1153249402 18:3106205-3106227 CCCTGTGGATACCAAAATCCAGG - Intronic
1156139697 18:34091548-34091570 AGTTCTGGAGTCCAAGATCTGGG - Intronic
1160944222 19:1633776-1633798 CCATCTGCACCCCAAGATCCTGG + Intronic
1162298062 19:9827289-9827311 TCTTCAGGACACCAAGAGCCTGG + Intronic
1163582694 19:18147741-18147763 CCTGCTAGACACCAGGATCCCGG - Intronic
1164539590 19:29113030-29113052 TCTCCTGCAGACCAATATCCAGG + Intergenic
1165131685 19:33636463-33636485 GCTTCTGGAGACAAAGACTCAGG - Intronic
1166220449 19:41360892-41360914 CCTTCTGTATACCAAGAGCTGGG - Intronic
1167100786 19:47403297-47403319 TCTTCTGGGGACCAAGGCCCAGG + Exonic
926057635 2:9784294-9784316 CATTCTGCAGCCCAAGATCAAGG + Intergenic
927645037 2:24872199-24872221 CCTTCTCGGGACCAAGGTCAGGG - Intronic
928696598 2:33855731-33855753 ATTTCTGGAGGCCAAGATCAAGG - Intergenic
929596385 2:43178952-43178974 CCTTCTGAAGACCAAGGTCTGGG + Intergenic
930291302 2:49496523-49496545 CCTTCCCTAGACCAATATCCTGG - Intergenic
931396822 2:61895314-61895336 ACTTGTGGAGCCCAAGATCCAGG + Intronic
932661391 2:73656107-73656129 ACTTCTGGAGACCAAGACTGGGG - Intergenic
933376107 2:81481802-81481824 CCTTCTGGAAGGCAAGACCCTGG - Intergenic
934945102 2:98535044-98535066 CTCTCTGGAGATCCAGATCCAGG - Intronic
935161061 2:100529898-100529920 CCCCCTGAAGACCAAGATCCCGG - Intergenic
935641135 2:105291327-105291349 AGTTCTGGAGGCCAAGATCCAGG - Intronic
936477413 2:112851545-112851567 CTTTTTGGAGACCAGGATTCAGG + Intergenic
937962543 2:127471732-127471754 CATACTGGAGACCAAACTCCAGG + Intronic
942950983 2:181721274-181721296 CCATCTGGAGATCAAGTGCCTGG + Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
948382301 2:237559303-237559325 CCAGCTGGAGACCTAGACCCAGG + Intergenic
1172999174 20:39093200-39093222 CCTTCTGGGGTCCCAAATCCAGG + Intergenic
1173740162 20:45394724-45394746 CCTTCTGGAGGCCCAGACCTCGG + Intronic
1173740220 20:45394987-45395009 CCTTCTGGGGGCCCAGATCTCGG + Intronic
1173982573 20:47236253-47236275 CCCTCGGGAGACCAAGATTCTGG + Intronic
1174883137 20:54302881-54302903 CCTCCAGGAGAACAAGAACCAGG + Intergenic
1175852678 20:62102148-62102170 CCCTCTGTGGTCCAAGATCCAGG + Intergenic
1177169340 21:17638521-17638543 GCTTCTGGAGTCCGAGAACCTGG - Intergenic
1177839675 21:26221775-26221797 CCTTCTGCAGATCAACAGCCAGG + Intergenic
1180073918 21:45452133-45452155 CCATCTGGGCACCCAGATCCTGG + Intronic
1180702070 22:17786707-17786729 CCTTCTGAGGAACAAGAGCCTGG + Intergenic
1180787865 22:18557053-18557075 CCTTCTGGAGGCCATGACTCTGG + Intergenic
1181105845 22:20574728-20574750 GTTTCTGGAGACCAGGCTCCTGG - Intronic
1181233871 22:21438253-21438275 CCTTCTGGAGGCCATGACTCTGG - Intronic
1181244776 22:21496578-21496600 CCTTCTGGAGGCCATGACTCTGG + Intergenic
1182449060 22:30407537-30407559 CCTGCTGAGGACCAAGATGCGGG + Exonic
1182618723 22:31606081-31606103 ACTGCTGGAGACCAAACTCCAGG - Intronic
1183530890 22:38352710-38352732 CCAGGTGGAGACCAAGAGCCAGG - Intronic
1183586752 22:38757207-38757229 CCTCCTGGAGACCACGGTGCTGG + Intronic
1183746267 22:39693863-39693885 GCTTCTGGAAACAAAGATCAGGG - Intergenic
1184188127 22:42878020-42878042 CCTGCTGGAGGCCAATATCCAGG + Intronic
1184479978 22:44740731-44740753 CCTTCTGGAGATGAATATCACGG - Intronic
1185139677 22:49093331-49093353 GCTTCTGGAGACGGAGATCCAGG + Intergenic
953147355 3:40290939-40290961 CCTTCTGGGGACCCAGACCTCGG - Intergenic
953262196 3:41350834-41350856 CCTTCTGGAGACCAACCTTCAGG + Intronic
957864521 3:86004908-86004930 CCTTCTGTAGATCAAGAGCCAGG - Intronic
959311426 3:104742118-104742140 CCTTCTTGATACCAATATCCTGG + Intergenic
960154533 3:114285126-114285148 CATTCTGGAGCCCTAGATCAAGG - Intronic
966116745 3:176472963-176472985 CCTTTTGGAGATCAACATTCAGG - Intergenic
967187716 3:186959751-186959773 ATTTGTGGAGACCCAGATCCTGG + Intronic
967936889 3:194736037-194736059 CCTTCAGGAGACAAAGAGGCAGG - Intergenic
968920339 4:3519106-3519128 CCTTCGTGAGGCCAAGAACCTGG - Intronic
969178819 4:5421668-5421690 TTTCCTGGAGACCAAGAACCTGG - Intronic
970353891 4:15233472-15233494 CCATCTGGGCACCAAGAGCCTGG + Intergenic
972680072 4:41297341-41297363 ACTTCTTGAGAACAAGAACCTGG + Intergenic
976324091 4:83751250-83751272 CCTTCTGGAGAACATGGTCCAGG - Intergenic
976754490 4:88483455-88483477 ACTTCGGGAGACCAAGGCCCAGG - Intronic
977087893 4:92628214-92628236 CCTTCTGGTGTCCATGATCACGG + Intronic
977160310 4:93626084-93626106 CCCTGTGGATACCAAAATCCAGG - Intronic
982369401 4:154618231-154618253 AATTCTGTTGACCAAGATCCAGG + Intergenic
985420573 4:189781332-189781354 CCTTCTGGAGACCCAGCAACAGG - Intergenic
987207106 5:15639173-15639195 ATTTCTGGATACAAAGATCCAGG - Intronic
988848410 5:35153934-35153956 CTTTCTGGAGGCAAGGATCCTGG - Intronic
989198068 5:38735139-38735161 CCTTCTTGAGAGCAGAATCCTGG + Intergenic
990206791 5:53438331-53438353 TGTTCCGGAGACCAACATCCAGG - Intergenic
995804607 5:116037472-116037494 CCTAGTGGAGACGAAGATTCTGG + Intronic
996362450 5:122664996-122665018 CCTGCTGGATACCAAAATCCAGG - Intergenic
1001908075 5:175489741-175489763 CCTTCTAGAGACTCTGATCCAGG + Intronic
1002312457 5:178323103-178323125 CCTTCTGCTGCCCCAGATCCAGG - Intronic
1002424234 5:179166246-179166268 CCTTCTTGGGACCAGGCTCCCGG - Intronic
1002557194 5:180051574-180051596 CCTTCTGGACACCTAAATGCTGG + Intronic
1004008210 6:11656335-11656357 TCTTCTGGAGACCATGAGCAGGG - Intergenic
1004796125 6:19086950-19086972 CTTACTGGAGACCAATATCAGGG + Intergenic
1006028938 6:31165130-31165152 CCTTCTCGAGCCCAAGCTGCTGG + Exonic
1009900206 6:69800376-69800398 TTTTCTGGGGACCAGGATCCAGG + Intergenic
1010859618 6:80892183-80892205 CCTTATGGAGCTGAAGATCCTGG + Intergenic
1010979787 6:82358762-82358784 CCTTGCGGATACCAAAATCCAGG + Intergenic
1011742855 6:90380423-90380445 CCCTCTGGATACCAAAATCCAGG + Intergenic
1012604462 6:101140789-101140811 TCTTCTGGAGAACAAGAACCAGG + Intergenic
1014018879 6:116565582-116565604 CCTTCTGGGGACCTAGATCTTGG - Intergenic
1014672032 6:124316865-124316887 CCTTCTGGATTCAAAGATTCAGG + Intronic
1018505485 6:164463334-164463356 CCTTCTGGAGAACATGGCCCCGG + Intergenic
1018621569 6:165734040-165734062 CCTTCTGGAGTCCTGGTTCCAGG - Intronic
1019651276 7:2160283-2160305 CCTGCTGGAGAACAAGAACATGG + Intronic
1019949819 7:4362324-4362346 CCTCCTGGAAACCATGAACCTGG + Intergenic
1021645204 7:22782810-22782832 CCTGCTGGACACCGAGGTCCTGG + Intergenic
1023618126 7:42041659-42041681 TTTTCTGGAGACCAAGAGCCTGG - Intronic
1030496647 7:110308972-110308994 CCTTATGCAGACGAGGATCCTGG - Intergenic
1031196906 7:118627257-118627279 CCTTCTGGGGGCCCAGATCTTGG + Intergenic
1032567146 7:132958055-132958077 CTTTCTGCAGACCAAGTACCTGG + Intronic
1032797797 7:135291513-135291535 CCTTCCGGTTACAAAGATCCAGG + Intergenic
1033157156 7:138966876-138966898 AGTTCTGGAGTCCAAGATCAAGG - Intronic
1035046993 7:155974204-155974226 CCACCTGGAGGGCAAGATCCAGG + Intergenic
1035859941 8:3017229-3017251 CCTTCAGAGGACCAAGCTCCAGG + Intronic
1037812712 8:22096458-22096480 CCTGCTGCAGCACAAGATCCTGG + Exonic
1037819454 8:22128714-22128736 CCTTCTGGAGACCAAGATCCTGG - Exonic
1038030226 8:23632041-23632063 CCTTCTGGGGACCAGGAGCAGGG - Intergenic
1042411260 8:68468771-68468793 CCTTCAGGAGAGCAAGAAGCTGG + Exonic
1043414497 8:80033513-80033535 CCTTCTGGGGACCCAGACCTTGG - Intronic
1045758142 8:105570115-105570137 CCTTAGGGAGGGCAAGATCCTGG + Intronic
1045793348 8:106012745-106012767 GCTTCTGGAGAACAAAATCTTGG - Intergenic
1046900524 8:119519022-119519044 ATTTGTGGAGACCAAGATTCTGG - Intergenic
1046994013 8:120495370-120495392 CCTTCTAGAGACAATGATTCTGG - Intronic
1047697376 8:127416655-127416677 CCTTCTCGAGCCCAAGCTGCTGG - Exonic
1048873818 8:138821098-138821120 CCTTCTGCAGCCCAGGTTCCAGG - Intronic
1053237514 9:36469160-36469182 ACTTCTGGAGAGAAGGATCCAGG - Intronic
1053392313 9:37744717-37744739 CCTTCTGGAGACCAAGGCCTTGG + Exonic
1057878139 9:98773162-98773184 CCTGCAGGAGACCAAGAGCCTGG - Intronic
1058833399 9:108839181-108839203 CTTCCTGGGGACCAGGATCCTGG + Intergenic
1060235754 9:121861609-121861631 CCTTCTGGAGACTAAGAGATAGG - Intronic
1061021802 9:128020539-128020561 CCTTGTGGAGGCCAACAACCCGG - Intergenic
1062115704 9:134806968-134806990 CTTCTTGGAGACCAAGATCTGGG - Intronic
1185663452 X:1745292-1745314 CCTTCTTGAGAAGAAGATGCTGG + Intergenic
1187067256 X:15853941-15853963 CTTTCTGGTCACCAAGATCTAGG - Intronic
1190097048 X:47490000-47490022 CCTTCTGAAGACAGAGGTCCTGG + Intergenic
1190223585 X:48528984-48529006 AGTTCTGGAGTCCAAGATCAAGG + Intergenic
1194172060 X:90599368-90599390 CCTTTTGAAGAACAAGACCCTGG - Intergenic
1197755730 X:129993042-129993064 CCTGCTGAAGACCAAGATTGAGG + Intronic
1200518292 Y:4177109-4177131 CCTTTTGAAGAACAAGACCCTGG - Intergenic