ID: 1037819611

View in Genome Browser
Species Human (GRCh38)
Location 8:22129349-22129371
Sequence CTGCATGTGGAGAGGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037819611_1037819617 7 Left 1037819611 8:22129349-22129371 CCATGCTGCCTCTCCACATGCAG 0: 1
1: 0
2: 6
3: 37
4: 428
Right 1037819617 8:22129379-22129401 CATCTTGCTCCTCCAGTGTGGGG 0: 1
1: 0
2: 2
3: 18
4: 250
1037819611_1037819616 6 Left 1037819611 8:22129349-22129371 CCATGCTGCCTCTCCACATGCAG 0: 1
1: 0
2: 6
3: 37
4: 428
Right 1037819616 8:22129378-22129400 ACATCTTGCTCCTCCAGTGTGGG 0: 1
1: 0
2: 3
3: 53
4: 509
1037819611_1037819615 5 Left 1037819611 8:22129349-22129371 CCATGCTGCCTCTCCACATGCAG 0: 1
1: 0
2: 6
3: 37
4: 428
Right 1037819615 8:22129377-22129399 CACATCTTGCTCCTCCAGTGTGG 0: 1
1: 0
2: 0
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037819611 Original CRISPR CTGCATGTGGAGAGGCAGCA TGG (reversed) Intronic
900381733 1:2387530-2387552 CTGCATGTGGACAAGGAGGAGGG + Intronic
900500804 1:3003639-3003661 CTGCAGCTGTGGAGGCAGCACGG - Intergenic
900515093 1:3077996-3078018 CTGAGTGTGGGGAGGCAGTAGGG - Intronic
900895348 1:5479362-5479384 CTGCCTGTGGGGATGCAGGAAGG + Intergenic
900911789 1:5601790-5601812 CGGGATGTGGAGACGCAGCATGG + Intergenic
900923506 1:5688904-5688926 CCCAGTGTGGAGAGGCAGCATGG + Intergenic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901718822 1:11178629-11178651 CTGGATGTGAAGAAGCAGAAAGG - Intronic
901726527 1:11247226-11247248 CTGCAAGTGGTGAGGCAGCTTGG + Intronic
901871995 1:12143554-12143576 GTGGATGTCGAGAGGCACCACGG + Exonic
902392967 1:16116769-16116791 CAGCCTGTGGAGAGTCAGAAAGG - Intergenic
902643808 1:17783948-17783970 CTGCAATTTGAGAGGCAGAATGG - Intronic
902839135 1:19064436-19064458 CTGCTTTTGGACAGCCAGCAAGG - Intergenic
902932207 1:19739670-19739692 CTTGAACTGGAGAGGCAGCAAGG + Intronic
902968998 1:20033143-20033165 CTGCCTGTTGAGAGGTAGTATGG + Intronic
903376620 1:22870452-22870474 GTGGGTGTGGAGAGGCAGGAGGG - Intronic
903437214 1:23359600-23359622 CGGGATGTGCAGAGGCAGCCAGG + Exonic
903547693 1:24136996-24137018 CTGCAAGGGGAGGGGCAGCTGGG - Intronic
903813789 1:26049818-26049840 GTGCAGGTGCAGGGGCAGCAAGG - Intergenic
904248352 1:29204297-29204319 CTGGTTTTTGAGAGGCAGCAGGG + Intronic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905684839 1:39901134-39901156 CTGCATGTGGAGCGGCTTCTCGG - Exonic
906058062 1:42931207-42931229 CTGCAGGGGGAGATGCAGCCTGG + Intronic
906721888 1:48012415-48012437 CTGCTTGTGGAGAGGCCTCAGGG - Intergenic
906814726 1:48867115-48867137 TTGCATTTGGATAGGCAACAAGG + Intronic
907286928 1:53386683-53386705 CAGCCTGGGGAGAGGCTGCAGGG + Intergenic
907536023 1:55158100-55158122 ATGCAGGTAGAGAGGCAGCAAGG + Intronic
911315722 1:96354511-96354533 CTGAATGAGATGAGGCAGCATGG - Intergenic
914939935 1:152013828-152013850 CACCATGTGGTGAGGCAGCCTGG + Intergenic
916107868 1:161443814-161443836 CTGGATGTGGGGAGCCAGCGAGG - Intergenic
916109453 1:161451196-161451218 CTGGATGTGGGGAGCCAGCGAGG - Intergenic
916111038 1:161458601-161458623 CTGGATGTGGGGAGCCAGCGAGG - Intergenic
916112626 1:161465987-161466009 CTGGATGTGGGGAGCCAGCGAGG - Intergenic
916315654 1:163445346-163445368 CTGCATAATGAGAGGCAGCCTGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916528347 1:165631972-165631994 CTTTATGTGGGGTGGCAGCACGG + Intronic
918429218 1:184441036-184441058 CTCCTTTTGGAGAGGCATCACGG + Intronic
920527988 1:206683007-206683029 CTGCCTTTTCAGAGGCAGCAAGG - Intronic
920702005 1:208225011-208225033 CTCCAGGCGGTGAGGCAGCAGGG + Intronic
920948839 1:210554085-210554107 CTGCATGTGGAGGGGCAGGGAGG + Intronic
921051229 1:211513271-211513293 CTGCATGGTGAGAAGCAGCATGG - Intergenic
921265962 1:213420831-213420853 CTGCATGTTCAGAGGGAGCGTGG - Intergenic
921312261 1:213855967-213855989 CTGCCTGGGCAGAGGCTGCAGGG + Intergenic
921607956 1:217177327-217177349 CTCCATGTGGGGACACAGCAAGG + Intergenic
921693728 1:218183153-218183175 CTGCTTCTGGAGAGGCCTCAGGG + Intergenic
923269827 1:232345673-232345695 CTTCCTGTTGCGAGGCAGCATGG + Intergenic
923467157 1:234259440-234259462 CTGCATCTGGAGAAGCATCCTGG - Intronic
923610102 1:235483797-235483819 GTGCATGTGAAGTAGCAGCATGG - Intronic
923892073 1:238227074-238227096 CTGCAGATGGAGTGCCAGCAAGG + Intergenic
1062979765 10:1712454-1712476 CTGCATGAGGAGAGGCTGTGTGG + Intronic
1062987374 10:1781435-1781457 CTGCATATGGAGCAGCAGAAGGG - Intergenic
1063146220 10:3297348-3297370 CTGCTTCTGGAGAGGCTTCAAGG - Intergenic
1063792202 10:9464645-9464667 ATGCATGTGCTTAGGCAGCAAGG + Intergenic
1063866385 10:10369296-10369318 CTGCGTGTTGAAAGGCAGGATGG - Intergenic
1065407746 10:25388607-25388629 CTGCTGGTGGAGGAGCAGCATGG + Intronic
1065655461 10:27944238-27944260 CGGCGGGTGGTGAGGCAGCACGG - Exonic
1066681608 10:37940776-37940798 CTGCAGCTCGAGAGGCAGCTTGG + Intergenic
1067311165 10:45114901-45114923 CTGCTTGTGGGGAGGCCTCAGGG + Intergenic
1067955891 10:50790094-50790116 CTGCCTTTGGAAAGGCAGGAAGG + Intronic
1068135721 10:52950005-52950027 CTGCAGCTTGAGAGGCAGCTCGG - Intergenic
1069649597 10:70035805-70035827 CTGAATATGGAAAGGCTGCATGG - Intergenic
1069925810 10:71850180-71850202 CTGGATCTGGAGAGGAAGGAAGG - Intronic
1070004293 10:72408038-72408060 CTGCAAGAGGAGAGACAGCAAGG + Intronic
1070011256 10:72476675-72476697 CTGTATCTGGAGAAGCACCATGG + Intronic
1070104576 10:73419174-73419196 CTACATGTGGAGGGGAAGGATGG - Intergenic
1070480739 10:76880350-76880372 CTCCTTGTGTTGAGGCAGCATGG - Intronic
1070780208 10:79133180-79133202 CTGCATGTGAAAAGGCAGGGAGG - Intronic
1071074300 10:81732720-81732742 CTGGATGTTGAGAGCCATCAAGG + Intergenic
1071549013 10:86551758-86551780 ATTCATGTGGAGAGGCAGGCTGG - Intergenic
1072321342 10:94253211-94253233 CTGCAGGTGTACAGGAAGCATGG + Intronic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1073821422 10:107268588-107268610 CTGCTTGAGGAGAGGTAGTAGGG + Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074850054 10:117432443-117432465 CTACATGAGGAAAGGCAGGAGGG - Intergenic
1075566229 10:123506440-123506462 CTGCATGGGAAGATGCAGGAAGG - Intergenic
1075586402 10:123661430-123661452 CTGCAAGTGGAGTGGGACCAGGG - Intergenic
1075642562 10:124075344-124075366 CTGGCTGGGGAGAGACAGCAGGG - Intronic
1075673802 10:124282109-124282131 CTGCTTCTGGAGAGGCCTCAGGG + Intergenic
1076278813 10:129227858-129227880 CAGCATCTTGAGAGGCAGAAAGG + Intergenic
1076500469 10:130932473-130932495 TGGCAGGTGGAGTGGCAGCATGG - Intergenic
1076598601 10:131642152-131642174 CTACAGGGGGAGAAGCAGCAGGG - Intergenic
1076598910 10:131644528-131644550 CTGCCGGTGGAGAGGCAGCACGG + Intergenic
1076612982 10:131737936-131737958 GTGCAAGTGCAGAGGCAGAAAGG + Intergenic
1076825319 10:132964325-132964347 CTGCAGGTGGAGAGGAGGCAAGG + Intergenic
1076995248 11:294533-294555 CTGCAGGGAGAGAGGCAGCCTGG - Intronic
1078181154 11:9012278-9012300 CTGCTGGTGGAGATGCAGAATGG - Intergenic
1078760820 11:14249982-14250004 CTACATTTGGAGAGGCAGCATGG - Intronic
1079737164 11:24011882-24011904 CAGCTTGTGGAGAGGCCTCAGGG - Intergenic
1080113968 11:28601209-28601231 CTGAAGGTGGAGGGGAAGCAAGG - Intergenic
1081358598 11:42144607-42144629 CTGCAGGTGCAGAGGCCTCATGG - Intergenic
1081692434 11:45087492-45087514 CTGCAGCTGGACAAGCAGCAGGG - Intergenic
1082088309 11:48068095-48068117 CCTCATTTGGAGAGGCAACAGGG + Intronic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1083670156 11:64295374-64295396 GCCCATGTGGAGAGACAGCATGG + Intronic
1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG + Intergenic
1083868415 11:65471469-65471491 CTGTATTTGGAGAGGCTGAAGGG + Intergenic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1083988194 11:66230667-66230689 CTGCAGATGGAAAGGAAGCAGGG + Intronic
1086166273 11:83782589-83782611 CTGCAGGTGGAAAGGGAGAAAGG + Intronic
1088679873 11:112230416-112230438 CTGTATGTGGACAGGTAGAAGGG + Intronic
1089004908 11:115083391-115083413 CTGCATGGAGGGAGGCAGGAAGG - Intergenic
1090043478 11:123310903-123310925 CTACAAATGGAGAGGCAACATGG - Intergenic
1091348877 11:134876861-134876883 GGGCATGTGGAGGGACAGCAAGG - Intergenic
1091479938 12:817485-817507 CAGCATTTGGAGAGGCAGATTGG + Intronic
1091526707 12:1309531-1309553 CCACCTGTGGAGAGACAGCATGG + Intronic
1091754551 12:3043015-3043037 CGGCTAGTGGGGAGGCAGCAGGG - Intergenic
1092138453 12:6166422-6166444 GTTCCTGTGGAGAGGGAGCATGG - Intergenic
1093441615 12:19204109-19204131 CTCCATGTTAAGAGGCAGGAGGG + Intronic
1097355919 12:58601649-58601671 ATGCATGTGGAAATCCAGCATGG - Intronic
1097356027 12:58602952-58602974 ATGCATGTGGAAATCCAGCAAGG + Intronic
1097694688 12:62764869-62764891 CTGCATGTGTGAAGGCCGCATGG + Intronic
1097962384 12:65545372-65545394 CTGCATGTGGAAAAGCAGGGAGG - Intergenic
1098330200 12:69344876-69344898 CTGCTTCTGGAGAGGCCTCAGGG - Intergenic
1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG + Intronic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100335267 12:93623277-93623299 CTGCAGGTGAAGGGGAAGCAAGG - Intergenic
1101725253 12:107383335-107383357 CCGCATTTTGAGAGGCAGCCTGG + Intronic
1101849043 12:108387673-108387695 CTGCTTCTGGAGAGGCCTCAGGG - Intergenic
1102169012 12:110827865-110827887 CAGGATGGGGAGAGCCAGCAGGG + Intergenic
1102485648 12:113253785-113253807 CTGTGTGTGGAGAAGCAGCAAGG + Intronic
1103684596 12:122722051-122722073 CGCCATGTAGAGAGGCATCAAGG - Intergenic
1103902439 12:124310412-124310434 TGGCATGAGGAGAGGCTGCAGGG + Intronic
1103962362 12:124617121-124617143 CTGCATGTGCAAAGGCCCCAGGG - Intergenic
1106027991 13:25973384-25973406 CTGCCTGTTTAGAGGCAGCCTGG - Intronic
1106138833 13:26993848-26993870 CAGCACCTGGGGAGGCAGCATGG + Intergenic
1106197791 13:27509088-27509110 CTGCTGGTGGAGATGCACCAGGG + Intergenic
1106395474 13:29376272-29376294 CTACATGTGGAGAGGCTAGAGGG + Intronic
1106448997 13:29862872-29862894 CTGGATGTAGGGAGGCACCATGG - Intergenic
1106477451 13:30110741-30110763 CTGCAGGTGGCAAGGGAGCAAGG - Intergenic
1106607439 13:31242173-31242195 CTGCAAGTCAGGAGGCAGCAAGG - Intronic
1107343418 13:39434087-39434109 TTGCATGCTCAGAGGCAGCATGG + Intronic
1108490451 13:50976229-50976251 CTGTATCTGAAGTGGCAGCAGGG + Intergenic
1108601029 13:51995452-51995474 CTGCTTGTGGACAGACAGCAGGG + Intronic
1111129431 13:83955485-83955507 CTTCATCTGGACAGTCAGCATGG + Intergenic
1113502441 13:110787142-110787164 CTGCCTCTGGAGAGGCCTCAGGG - Intergenic
1113569421 13:111343278-111343300 CTTCCTGTGGGGAGGCTGCAGGG + Intronic
1113777813 13:112958708-112958730 CTGCATGAGGAGAGGCCCCAGGG - Intronic
1114621618 14:24099479-24099501 CTGCATGGGGAAGGGCAGCTAGG - Intronic
1115993922 14:39175779-39175801 CTGCACGTGGACAGGAAGCTGGG - Intronic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1118305921 14:64655327-64655349 CTCCATTTGGAGAGGCAGCTTGG + Intergenic
1118709843 14:68510148-68510170 CTGGATGGGGAGTGGCAGTAGGG - Intronic
1119187087 14:72650688-72650710 AGGCAGATGGAGAGGCAGCATGG - Intronic
1119601611 14:75980625-75980647 ATGCATGGGGAGAGGGAGGAAGG - Exonic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1121125336 14:91403146-91403168 CGCCAGGTGCAGAGGCAGCAAGG - Intronic
1124082808 15:26517106-26517128 CTGCTTCTGGAGAGGCCTCAGGG - Intergenic
1124364467 15:29062250-29062272 CTGCATACGGGGAGGCTGCACGG + Intronic
1126145058 15:45466210-45466232 CTGCTTCTGGAGAGGCCTCAGGG - Intergenic
1126697655 15:51339955-51339977 CTGCATCTGGGGAGGCCTCAGGG + Intergenic
1126954252 15:53914583-53914605 CTGCAGGTGTCGGGGCAGCAGGG + Intergenic
1127549554 15:60023384-60023406 CTGGATGGGGAGAGGGAACAGGG + Intronic
1127962598 15:63900818-63900840 CACCGTGTGAAGAGGCAGCAAGG + Intergenic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128579475 15:68798760-68798782 CTGCAAGTGGAGAAGAGGCAGGG + Intronic
1129224670 15:74162039-74162061 CTGCCTGTGGAGCGGAAGAATGG + Intergenic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129333779 15:74840646-74840668 AGGCAAGAGGAGAGGCAGCAGGG + Intronic
1129951838 15:79598948-79598970 CTGCATTTTGAGAGACAGGAAGG + Intergenic
1130384706 15:83400997-83401019 GTGCATGTGGAAAGGGAGCAAGG + Intergenic
1131034269 15:89210874-89210896 TGCCATGAGGAGAGGCAGCAGGG - Intronic
1131054200 15:89365936-89365958 CTGCAGGAGGAGGGGAAGCAAGG + Intergenic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1132615683 16:840225-840247 CTCCCTGTGGAGGGGCAGCCTGG + Intergenic
1133499108 16:6348593-6348615 CTGCATCTGGGGAGGCCTCAGGG + Intronic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1136057729 16:27702869-27702891 CTGCATGTGAAAAGGCCGCCCGG + Intronic
1136085784 16:27884000-27884022 CTCCACGTGGAGATGCTGCATGG - Intronic
1136232545 16:28895081-28895103 CAGCCTGTGGAGAAGCTGCAGGG - Intronic
1137005930 16:35274370-35274392 CTACAGGTGGAGAGGCCACAGGG + Intergenic
1137439706 16:48487608-48487630 CTACTTGTGGTGAGGAAGCAAGG - Intergenic
1137923960 16:52521811-52521833 CTGGGTGTGGAGCGGCAACATGG + Intronic
1138347100 16:56326746-56326768 CTCCATGGGCAGAGGCAGGAGGG + Intronic
1138379440 16:56590003-56590025 CAGGATGTGGAGAGACAGCCAGG + Intronic
1138554341 16:57763114-57763136 CTGGCTGTGGGGAGACAGCAGGG - Intronic
1139067502 16:63336543-63336565 CTGCTTCTGGAGAGGCCTCAGGG + Intergenic
1140088387 16:71816749-71816771 TGGCACGTGGAGAGGCAGGAAGG - Intergenic
1141296521 16:82774822-82774844 CTGCACCTGGTGGGGCAGCATGG + Intronic
1142867523 17:2799765-2799787 CTGCCTCTGGAGAGGGAGGAGGG + Intronic
1144441759 17:15289438-15289460 CGGCAAGGGGAGAGACAGCATGG - Intergenic
1145960805 17:28885640-28885662 CTGCAAGTGGGGAAACAGCAAGG - Intronic
1146454959 17:33002225-33002247 CTGCATGTGGATAGAAAGGAGGG - Intergenic
1147522791 17:41190367-41190389 CAGCATGTTGGGTGGCAGCAAGG - Exonic
1147526819 17:41232736-41232758 CAGCATGTGGGCTGGCAGCAGGG - Exonic
1147988965 17:44321885-44321907 CTGCATGTGTAGAGGCAGGGAGG - Intronic
1148026639 17:44593431-44593453 CTGCATGGGGTGGGGCAGGAGGG + Intergenic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1149611706 17:57962286-57962308 CTGCAGGTGGAGGAGCCGCATGG + Intergenic
1150168270 17:62965932-62965954 TGGCATTTGGAGGGGCAGCAGGG - Intergenic
1151352700 17:73541169-73541191 CTGGCTGGGGAGAGGCAGCTGGG + Intronic
1151628849 17:75296141-75296163 GTGGAGGTGCAGAGGCAGCAAGG - Intergenic
1153365217 18:4248143-4248165 AGGCTTTTGGAGAGGCAGCAAGG - Intronic
1153600969 18:6781168-6781190 TTGCATCTGGAGAGGCAGTCGGG + Intronic
1153971995 18:10235504-10235526 ATGGAAGTGGAGAGGCAGGAGGG - Intergenic
1154100527 18:11468870-11468892 GTGCATGTGGAGAGGAACCTGGG - Intergenic
1157121686 18:44917338-44917360 CTGCCTGGGGAGAGGCAGTTTGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158564252 18:58541194-58541216 CTGCTTCTGGAGAGGCCTCAGGG + Intronic
1160242491 18:77133203-77133225 CTGCAGGAGGAGAGTCAGCCCGG + Intronic
1160318200 18:77867316-77867338 CTGCAGGTGGAGAGGAAGGTGGG - Intergenic
1160471200 18:79135507-79135529 CTGCAGGTGGAGTGGCACTAAGG - Intronic
1161235004 19:3193360-3193382 CTGCTTGTAGATAGACAGCAGGG - Exonic
1161592978 19:5137051-5137073 CTGCATGTGGAGCGAGAGAAAGG - Intronic
1161669498 19:5597634-5597656 CAGCTTGAGGAGATGCAGCACGG - Intronic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1162041660 19:7974621-7974643 CTGCCTGTGAAGGGGCAGCCTGG + Intronic
1163011447 19:14429089-14429111 CTCCATCTGGGGAGGCAGCCTGG + Intergenic
1163185481 19:15636154-15636176 CTGCTTGAGGAGAGGCAGCTTGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163632032 19:18422382-18422404 CTGCCAGTGGGGAGGCTGCAGGG + Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164705300 19:30314922-30314944 CTGCAGGTAGAGAGCCAGCAGGG - Intronic
1165339931 19:35204179-35204201 CTGCATGTAGGGAGGCTGGACGG - Intergenic
1166196181 19:41207330-41207352 GTGTGTGTGGAGGGGCAGCAGGG - Exonic
1166960004 19:46491604-46491626 CTGGAAGTGGGGAGGCATCAGGG + Exonic
1168344185 19:55642492-55642514 CAGCATCTGGAGCGGCAGCTGGG - Exonic
927689526 2:25197971-25197993 CAGGCTGTGGAGAGGCAGCATGG + Intergenic
927708872 2:25313165-25313187 CAGCCTGTGGAGACCCAGCAGGG + Intronic
928128021 2:28629480-28629502 CTCCCTGTTGAGAAGCAGCATGG + Intronic
929937276 2:46302562-46302584 CATCATGTGAACAGGCAGCATGG - Intronic
930622585 2:53659377-53659399 GTGCATGTGGTGAGGGACCAAGG + Intronic
931150196 2:59564703-59564725 CTGCTCATGGAGAGGAAGCAAGG - Intergenic
931836832 2:66108012-66108034 CTGCATGTGGATAGACATCAGGG + Intergenic
931848006 2:66224659-66224681 CTACATGTGGCGAGGCAGCATGG + Intergenic
932574208 2:72954009-72954031 CTGTAAGTGGGGAGGCAGGAAGG + Intronic
933482118 2:82870639-82870661 CTGCTTCTGGAGAGGCCTCAGGG + Intergenic
934067078 2:88350498-88350520 CTGCAGGTGGAGAGGGAGTGGGG + Intergenic
934218087 2:90052688-90052710 GTGCATGTGGACAGGCAGTGGGG - Intergenic
935088416 2:99870510-99870532 CTGCATGGGTAGATCCAGCAGGG - Intronic
936741585 2:115518002-115518024 CTGCATGTGCAGAGATAACATGG + Intronic
937013448 2:118582339-118582361 CTCCACGTGCAAAGGCAGCAGGG - Intergenic
937441210 2:121917705-121917727 CTGACTGTGGAGTGGGAGCATGG + Intergenic
938015616 2:127864699-127864721 CTTCATCTGGGGAGGCTGCAGGG + Exonic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
938650650 2:133379589-133379611 CTCCATGTGGACAGGAACCATGG + Intronic
941226015 2:162849117-162849139 CAGAAGGTGAAGAGGCAGCAAGG + Intergenic
941618853 2:167754659-167754681 CTTGATGTGGAAAGGTAGCAAGG - Intergenic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
944326072 2:198405164-198405186 TTGCATTTAGAGAGGCAGTATGG + Intronic
944422907 2:199549772-199549794 CTGCTTCTGGAGAGGCTTCAGGG - Intergenic
946062833 2:216959535-216959557 CTGCAAGGGGAGTGGGAGCAGGG + Intergenic
947793493 2:232880520-232880542 CGGCAGGAGGAGAGGAAGCAGGG + Intronic
947856259 2:233326626-233326648 CCTCATGTGGCCAGGCAGCAAGG - Intronic
948151007 2:235744609-235744631 CTGCATGGCGGCAGGCAGCAGGG - Intronic
948612740 2:239180139-239180161 CTGGCTGTGCAGGGGCAGCAAGG - Intronic
948668074 2:239548657-239548679 CTGAGGGTGGAGAGGCAGGAGGG + Intergenic
948692592 2:239715956-239715978 CTCCCTGTGGAGAGACGGCACGG - Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169428262 20:5512797-5512819 CAGTATTGGGAGAGGCAGCAGGG + Intergenic
1169500843 20:6158923-6158945 CTGCCTGTGGGGAGCCAGGATGG - Intergenic
1169977731 20:11349261-11349283 CTGCATCTGGGGAGGCCTCAGGG - Intergenic
1170152614 20:13241186-13241208 CTGCAGTTGCAGAGGCATCATGG + Intronic
1170822622 20:19767224-19767246 CTGCTTGGGGAGATCCAGCAAGG + Intergenic
1171426338 20:25050985-25051007 CTGCATGTGGCGAGGCACCTGGG - Intronic
1172631601 20:36382116-36382138 CTGGAGGTGGAGAAGCAGCCTGG + Intronic
1172962771 20:38810188-38810210 CAGCATGTGCAGAGGCACCGAGG + Intronic
1173583145 20:44161411-44161433 ATGTGTGTGGAGAGGCAGCAGGG + Intronic
1174384767 20:50180687-50180709 CAGCATGTGCAGAGGCCACATGG + Intergenic
1175189088 20:57199203-57199225 CTGCACGGGGAAGGGCAGCAGGG - Intronic
1175646862 20:60682088-60682110 CTGCATGTGGAGATGTAAAATGG - Intergenic
1175705095 20:61170952-61170974 CTGGATGGGCAGAGGCAGCTGGG - Intergenic
1176020443 20:62959890-62959912 CTGGATGTGGAGGAGCTGCATGG + Intronic
1176673658 21:9757258-9757280 ATACTTGTGGATAGGCAGCAAGG + Intergenic
1177565003 21:22808964-22808986 CTGCTTCTGGAGAGGCCTCAGGG - Intergenic
1177590262 21:23154857-23154879 CTGAATCAGAAGAGGCAGCAGGG + Intergenic
1179183327 21:39063096-39063118 GTGCATGGGGACAGGCAGCAGGG + Intergenic
1179346787 21:40565699-40565721 ATGCATGTGGACAGGCAATATGG - Intronic
1179928257 21:44550327-44550349 CTGGGTGCGGAGAGTCAGCACGG + Intronic
1179939428 21:44628386-44628408 CTGGGTGCGGAGAGTCAGCACGG - Intronic
1179996172 21:44975483-44975505 CTGCACGGGGAGGGGCTGCAGGG - Intronic
1180224934 21:46386615-46386637 CTGCAGGTGAGGAGGCACCAAGG - Intronic
1181174448 22:21027822-21027844 CTGGAGATTGAGAGGCAGCAGGG - Exonic
1181415174 22:22754116-22754138 GTGGATGTGGAGGGGCAGCTAGG - Intronic
1182150037 22:28021379-28021401 CTGCCTGGGGAGGGGCAGCTAGG + Intronic
1182242256 22:28925440-28925462 GTGCATGGGTAGAGGCATCATGG - Intronic
1182980624 22:34667431-34667453 CTGCTTCTGGAGAGGCCTCAGGG + Intergenic
1183373312 22:37448013-37448035 GTGCATGTAGAGAGGCAGTTTGG - Intergenic
1184093628 22:42305108-42305130 CTGCATGGGGAGGGGCTCCAGGG - Intronic
1184595029 22:45508682-45508704 CTGCCTCTGCAGAGGCTGCATGG + Intronic
1184766140 22:46573519-46573541 GTGCATGTGGAGTGACAGCCTGG + Intergenic
1185097762 22:48821049-48821071 CTGCATGTGTGGAGCCAGGATGG - Intronic
1185209679 22:49563657-49563679 CTGCTTGTGGGGAGGCCTCAGGG + Intronic
950689908 3:14647392-14647414 CTGGATTTAGAGAGGCAGCAGGG - Intergenic
950797749 3:15524087-15524109 CTGTATGTGCAGAGGCTCCAAGG - Intergenic
951300933 3:20995324-20995346 CTGAATCTGGAAAGGAAGCAAGG + Intergenic
953181838 3:40602854-40602876 AGCCATGTGGAGAGGCTGCATGG - Intergenic
953240809 3:41147916-41147938 CTGCATGTGGGGAGGAAGTTGGG - Intergenic
953460284 3:43076468-43076490 CTGTAGGTGGGGTGGCAGCAGGG - Intergenic
954049343 3:47960173-47960195 CAGCATGTGGAGGGGCAAAATGG - Intronic
954749312 3:52804709-52804731 CTGCATCTGCAGGTGCAGCAAGG - Exonic
954788227 3:53110943-53110965 CTCAATGTGGAGGGCCAGCAAGG - Intronic
955660867 3:61297673-61297695 GTGCATGTGGAGAGGAAGCAAGG + Intergenic
956146606 3:66197289-66197311 CTGTATGAGGATAGGCATCAGGG + Intronic
956800480 3:72753486-72753508 ACACATGTGAAGAGGCAGCAGGG - Intronic
956935541 3:74096640-74096662 CAGCATGGGGGGAGGGAGCATGG + Intergenic
957434831 3:80161330-80161352 CAGCATGTAGAGAGGAACCAAGG - Intergenic
960057842 3:113288331-113288353 CTTCATGTGGAAGTGCAGCATGG + Exonic
960623797 3:119660878-119660900 CAGAATGAGGAGAGCCAGCATGG + Intronic
961091799 3:124119143-124119165 CTGCAAGGCGAGAGGCAACAGGG + Intronic
961216558 3:125164739-125164761 CTGCATGAGTAGAGGCTGAAAGG + Intronic
961315445 3:126032387-126032409 CTGCATGCTGAGAAGCAGCTGGG + Intronic
962119196 3:132544283-132544305 CTGCATGGGGAAACCCAGCAAGG + Intergenic
962201325 3:133403327-133403349 CTGCAGGTGGAGAAACAGGAGGG - Intronic
963850056 3:150202009-150202031 CTGCCTGTAGCCAGGCAGCAGGG + Intergenic
964031066 3:152139463-152139485 AAGACTGTGGAGAGGCAGCATGG + Intergenic
964709648 3:159658075-159658097 GTGCATATGGAGAGGAAGAATGG + Intronic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
965789461 3:172372281-172372303 CTTCATGGGCACAGGCAGCAGGG + Intronic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
967594052 3:191309828-191309850 CAGCTTGTGGAGAGGCCTCAGGG - Intronic
968376717 4:50078-50100 CTGCAGGAGGAGAGCCTGCAGGG - Intergenic
968490325 4:886704-886726 CTGCGTGTGGAGCGTCAGCAGGG - Intronic
969168724 4:5341325-5341347 TTGCATCTGGGGAGGCAACAAGG - Intronic
969425948 4:7123875-7123897 CTGGAGGTGGAGAGGCCGCCAGG + Intergenic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
969893266 4:10279345-10279367 AAGTATGTGGAGAGGGAGCAAGG + Intergenic
971103844 4:23499460-23499482 CTGCCTCTGGAGAGGCCTCAGGG - Intergenic
971201581 4:24514029-24514051 CAGCAGGGGGAGAGGGAGCACGG + Intergenic
971265573 4:25093758-25093780 CTGCATGTGGAGCACCAGGAGGG - Intergenic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
972354964 4:38271768-38271790 CGGCTTCTGGGGAGGCAGCAGGG - Intergenic
972607424 4:40626693-40626715 CTGTATGGGGAGAGGCAGTGGGG - Intronic
973619171 4:52710703-52710725 ATGCATGTGGTCAGGCAACATGG - Intergenic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974786184 4:66621998-66622020 TTGCATTTGGGGAGGCAGAAAGG + Intergenic
976140299 4:81984584-81984606 CTGCATGTGGAGGAGGAACAAGG + Intronic
977462913 4:97348258-97348280 CTGAATGTGGAAACTCAGCAAGG + Intronic
979198102 4:117943954-117943976 CTGCAGGTGTACAGGAAGCATGG + Intergenic
981238583 4:142447841-142447863 CTACATGAGAGGAGGCAGCAAGG + Intronic
982481504 4:155917495-155917517 CAGCATGTGGGGAAGCAACATGG - Intronic
982636126 4:157898974-157898996 CTGCATGTGGAGAGACTCCTAGG + Intergenic
983381186 4:166996358-166996380 CTGCAGCTGCACAGGCAGCAAGG + Intronic
984784914 4:183558669-183558691 CAGGAAGTGGAGACGCAGCAAGG + Intergenic
984959865 4:185086233-185086255 CAGCTTGGGGAGCGGCAGCAGGG + Intergenic
985401050 4:189594411-189594433 ATGCTTGTGGATAGGCAGCAAGG - Intergenic
986167239 5:5285279-5285301 CTGCAGGTGGAAAGGCAGCATGG - Intronic
986250939 5:6058238-6058260 CCGCGAGTGGAGAAGCAGCACGG - Intergenic
987650744 5:20737045-20737067 CTGCTTCTGGAGAGGCCTCAGGG - Intergenic
987905817 5:24075698-24075720 CTGCATGTGCAGAGAGAGAATGG + Intronic
988302640 5:29450571-29450593 CTGCTTCTGGAGAGGCCTCAGGG - Intergenic
988485622 5:31666004-31666026 TTGGAGGTGGAGAGGCAGCGTGG + Intronic
988744811 5:34124418-34124440 CTGCTTCTGGAGAGGCCTCAGGG + Exonic
990416995 5:55596311-55596333 CTGCATGTGGGGAGGAAAGATGG + Intergenic
993173419 5:84451438-84451460 CAGCTTGGGGAGGGGCAGCATGG - Intergenic
993364398 5:87018969-87018991 CTCCATGTAGAGAGGGAGAAGGG + Intergenic
993524885 5:88953145-88953167 CTGAAAGTGGAGATTCAGCAAGG + Intergenic
994146698 5:96403042-96403064 GTGCATGTGTGGAGGCAGGAAGG + Intronic
996217922 5:120891771-120891793 CTCCATGTAGGGAGGCAGAAGGG + Intergenic
996232951 5:121088411-121088433 CTGCATAGGAAGAGGAAGCATGG + Intergenic
997718851 5:136062230-136062252 CTTCAAGAGGAGAGGCTGCAGGG + Intronic
998767304 5:145502149-145502171 CTGCATCTGGGGAGGCCTCAGGG + Intronic
999095473 5:148974127-148974149 GTGCATGTGGAGAAGCTACAGGG - Intronic
999232282 5:150068751-150068773 AGGCATGTGGAGAAGCTGCAGGG - Intronic
999692288 5:154158526-154158548 CTGCATGTGTAGGGAGAGCAGGG - Intronic
1000933913 5:167285131-167285153 CTGCTTTTGGAGATCCAGCATGG + Intronic
1001037698 5:168309494-168309516 CTGCCTGTGGAGAGGGGGCTGGG - Intronic
1001964304 5:175899778-175899800 CTCCATGGGATGAGGCAGCAGGG - Intergenic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1003223754 6:4186649-4186671 CTGCAAGTGGAGAGGTATCCAGG - Intergenic
1004037275 6:11935643-11935665 CAGCATGTCAACAGGCAGCAGGG - Intergenic
1005494909 6:26379930-26379952 GTCCATGTGGTGAGGCTGCAGGG - Intergenic
1005499346 6:26416518-26416540 GTCCATGTGGTGAGGCTGCAGGG - Intergenic
1005504133 6:26455343-26455365 GTCCATGTGGTGAGGCTGCAGGG - Intergenic
1006337793 6:33429506-33429528 CTGGGTGTGGAGAGGAAGAAAGG + Intronic
1006807756 6:36799552-36799574 CTGCAGGCGGGGAGGCTGCAGGG + Intronic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1006864974 6:37202027-37202049 CTGCATGTGGAGAGTGAACTTGG - Intergenic
1006992639 6:38228495-38228517 GTGCATGTAGAGGGGCAGAAGGG + Intronic
1007116738 6:39348391-39348413 CTGCATGAGGTGGGGCAGCTGGG - Intronic
1007375180 6:41451591-41451613 CTGCTTGTGGAGAGTCACCCGGG - Intergenic
1008974727 6:57411210-57411232 CTGCATCTGGGGAGGCCTCAGGG - Intronic
1008976838 6:57437052-57437074 CTGCTTCTGGGGAGGCATCAGGG + Intronic
1009164980 6:60329997-60330019 CTGCTTCTGGAGAGGCATCAGGG + Intergenic
1009778214 6:68233743-68233765 CTGAGTGCGGAGAGGCAGTAGGG - Intergenic
1010594573 6:77748252-77748274 CTGCAGGGGGAGAGGCCTCATGG - Intronic
1010761830 6:79732838-79732860 GGGCATGTGGAGAGGCACCTGGG - Intergenic
1012809384 6:103938374-103938396 CTGCGTCTGGAGAGGCCTCAGGG + Intergenic
1013779057 6:113710369-113710391 GCGCATGGGGAGAGGCAGAAGGG - Intergenic
1017786920 6:157763867-157763889 CAGTATTTGGAGAAGCAGCAAGG - Intronic
1018163314 6:161069403-161069425 TTCCAGGTGGGGAGGCAGCATGG + Intronic
1018625512 6:165774670-165774692 CTGCTTCTGGAGAGGGAGGAAGG + Intronic
1018915640 6:168130865-168130887 CTGCCTGTGCTGGGGCAGCAGGG + Intergenic
1019116290 6:169765123-169765145 CTGCATGGGGATTGGCTGCACGG + Intronic
1019452321 7:1106211-1106233 CCGCATGTGGAGAGTCCGCGTGG - Intronic
1022521782 7:31013145-31013167 CTGCAAGTGGAGTAGCAGCTAGG + Intergenic
1023470004 7:40507503-40507525 CTGAATGTGGATGGGTAGCAGGG - Intronic
1024927008 7:54627775-54627797 CTGCATTGGGGGAGGCTGCATGG - Intergenic
1026676742 7:72434645-72434667 TTCCAGGGGGAGAGGCAGCAAGG + Intronic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028888608 7:95961897-95961919 AACCATGTGGAGAGGGAGCAAGG - Intronic
1029306723 7:99625098-99625120 CAGCAAGTGGAGGGGCAGGATGG - Intronic
1029852670 7:103481067-103481089 CAGCATGTTGACAGGGAGCAAGG + Intronic
1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG + Intergenic
1030523125 7:110622562-110622584 CTGCAAGTCCAGAGGCAGTATGG + Intergenic
1030780039 7:113589248-113589270 CTGCTTCTGGAGAGGCCTCAGGG + Intergenic
1030896448 7:115066345-115066367 CTGTGTGTGAAGGGGCAGCATGG + Intergenic
1032442937 7:131956039-131956061 GTGAATGTGGGGAGGCAGGAAGG - Intergenic
1032712677 7:134474709-134474731 GTGCATGTGGAGAGACAGAGAGG - Intergenic
1033442717 7:141395016-141395038 TTGCAGGTGAAGAGGCGGCAGGG - Intronic
1033521084 7:142160957-142160979 CTGGGTGTGGGCAGGCAGCAGGG - Intronic
1033578461 7:142709681-142709703 AGGAATGTGGGGAGGCAGCATGG + Intergenic
1033672913 7:143510845-143510867 CTGCATGGGGAAAGCCAACAAGG - Intergenic
1037185598 8:16058774-16058796 CTGCTTCTGGAGAGGCCTCAGGG + Intergenic
1037801862 8:22040369-22040391 CCCCAAGTGGGGAGGCAGCATGG - Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1038010915 8:23475156-23475178 CTGCATGGGGAGAGGCTGCCTGG + Intergenic
1038439524 8:27561662-27561684 CTGCCTTTGGAGAGGCAGATGGG - Intergenic
1039466064 8:37786309-37786331 CTGGATGTGGAGAGGGGGAAAGG + Intronic
1040835110 8:51723017-51723039 CTGTATGTGGAGATGCAAAATGG + Intronic
1041102663 8:54412308-54412330 CTGCAGGTGAGGAGGAAGCATGG - Intergenic
1041438352 8:57866659-57866681 CTGCATCAGGGGTGGCAGCAGGG + Intergenic
1041974795 8:63785209-63785231 CTGCATTTGGTGAGGCAGGAGGG + Intergenic
1041987924 8:63948479-63948501 CTCAATGTGAATAGGCAGCAAGG + Intergenic
1043826279 8:84932673-84932695 CTACAGGTAGAGAGGAAGCAAGG - Intergenic
1044596371 8:93962652-93962674 CTGCTTGTGGCGAGGCCTCAGGG + Intergenic
1045620654 8:103973960-103973982 CTGCCAGTGGAGAGTCAGCAAGG - Intronic
1046947447 8:119987724-119987746 CTGCCTCTAGAGAGGCAGCCTGG + Intronic
1047377649 8:124317808-124317830 CTGCATCTTCAGAGCCAGCAAGG - Intronic
1047433622 8:124815824-124815846 CTGAATGCTGAGAGGCACCAGGG + Intergenic
1048346960 8:133583277-133583299 AGGCATGTGGAGAGGCCACATGG - Intergenic
1049001614 8:139829018-139829040 CTACATTTGGAGACGCAGAATGG + Intronic
1049253302 8:141600828-141600850 CTGCATGTGTAGAGGGTGCCTGG - Intergenic
1049583658 8:143423444-143423466 GTGCACGGGGAGGGGCAGCACGG - Intronic
1049589515 8:143450557-143450579 CTGCTTCTGGAGAGGCCTCAGGG + Intronic
1049930293 9:449677-449699 CTGAATTTGAAGAGGCAGCTAGG - Intronic
1050265520 9:3885407-3885429 CTGCATGAGGAGCAGCACCATGG - Intronic
1050545803 9:6707736-6707758 TTGCTTATGGATAGGCAGCAAGG - Intergenic
1051369811 9:16348681-16348703 CCGCATGAGGAGAGGCATGAGGG + Intergenic
1052384624 9:27808607-27808629 CTGCCTGTTGAGAGGTAGTATGG + Intergenic
1053290855 9:36878907-36878929 ATGCATGAGAAGAGACAGCAAGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053442574 9:38128268-38128290 CTGCATGCTGAGTGGCAGCGAGG + Intergenic
1054927253 9:70601458-70601480 CTGACTGTGAAGAGGCAGGAAGG + Intronic
1054928622 9:70613681-70613703 CTGCCTGTGGAGAAGAAGCTTGG + Intronic
1055785279 9:79864155-79864177 CCGCATGTGGGGAGATAGCAGGG - Intergenic
1055828940 9:80358320-80358342 CTGCAGGTGGGGAGGTAGCAGGG + Intergenic
1055829078 9:80359060-80359082 CTGCAGGTGCGGAGACAGCAAGG + Intergenic
1055856050 9:80690188-80690210 CTGCATCTGGGGAGGCCCCAGGG - Intergenic
1056109187 9:83377695-83377717 CTGCTTCTGGGGAGGCATCAGGG - Intronic
1056160451 9:83886087-83886109 CTGCCTGTGGGGAAGCAGCATGG - Intronic
1056359765 9:85843780-85843802 CTGCCTGTGGGGAAGCAGCATGG + Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057325551 9:94060576-94060598 CTGCAGGTGTACAGGAAGCATGG + Intronic
1057873313 9:98734062-98734084 GGGCATGTGTGGAGGCAGCACGG - Exonic
1058288559 9:103209919-103209941 CTGCATGAGCAGAGCCATCATGG - Intergenic
1058637464 9:107050274-107050296 CAGCATGTGCAAAGGCACCAGGG - Intergenic
1060477287 9:123996407-123996429 CACCATTTTGAGAGGCAGCAAGG - Intergenic
1060600087 9:124871450-124871472 CTGCAGATAGAGCGGCAGCATGG + Intronic
1061577054 9:131513894-131513916 GGGCCTGTGCAGAGGCAGCAAGG - Intronic
1062107179 9:134762081-134762103 CCGCATGTGGAGGGCCAGCTGGG + Intronic
1062172062 9:135140366-135140388 GTGCAGGTGGAGAGGCACCCAGG - Intergenic
1062331906 9:136048637-136048659 CTGCAGGCGGAGAGGGAGCCAGG + Intronic
1062609171 9:137366216-137366238 CTGCATGAGAAGAGCCACCACGG + Intronic
1203572513 Un_KI270744v1:144168-144190 CTGCAGGAGGAGAGCCTGCAGGG + Intergenic
1186432593 X:9517663-9517685 CGGCATTTGGAGAAGCACCAGGG - Intronic
1187144067 X:16621495-16621517 GAGCATGTGGAGAAGCAGGATGG + Intronic
1189129693 X:38485392-38485414 CAGCATGGGGAGAGGCAGATTGG + Intronic
1190415882 X:50180121-50180143 ATTCATGTGGAGAGGCACAATGG + Intergenic
1190499850 X:51063510-51063532 CTGCTTCTGGAGAGGCCTCAGGG - Intergenic
1192551156 X:72054846-72054868 CTGCAGGGGGAGGGGCATCATGG - Intergenic
1193370550 X:80691961-80691983 CTTCATCTGGAAAGGCAGCTAGG + Exonic
1195300156 X:103521766-103521788 CTGCTTCTGGAGAGGCCTCAGGG + Intergenic
1196756997 X:119166727-119166749 CTGTATGTGCAAAGGCTGCATGG - Intergenic
1198999961 X:142624105-142624127 CTGCTTCTGGAGAGGCCTCAGGG + Intergenic
1199093650 X:143717134-143717156 TTGCCTGTTGAGAGGTAGCATGG - Intronic
1199214683 X:145251026-145251048 TTGCCTGTTGAGAGGCAGCATGG + Intronic
1199245593 X:145600106-145600128 CTGCATGTGGGGTGGCAACATGG - Intergenic
1200480132 Y:3691549-3691571 CTGCTTCTGGAGAGGCCTCAGGG - Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1201887686 Y:18903819-18903841 CTGCAGGTGAAGGGGCAGTAAGG - Intergenic