ID: 1037819978

View in Genome Browser
Species Human (GRCh38)
Location 8:22130796-22130818
Sequence CCCGGGGCGCGTGTTCCCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037819978_1037819985 -4 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819985 8:22130815-22130837 CGGGTCGGAGATGGCCGAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 126
1037819978_1037819991 10 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819991 8:22130829-22130851 CCGAGTTGGGGGAAAGGCCGAGG 0: 1
1: 0
2: 0
3: 16
4: 148
1037819978_1037819992 11 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819992 8:22130830-22130852 CGAGTTGGGGGAAAGGCCGAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1037819978_1037819993 12 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819993 8:22130831-22130853 GAGTTGGGGGAAAGGCCGAGGGG 0: 1
1: 0
2: 2
3: 44
4: 433
1037819978_1037819997 22 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819997 8:22130841-22130863 AAAGGCCGAGGGGCCGGGGAAGG 0: 1
1: 0
2: 4
3: 42
4: 509
1037819978_1037819995 17 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819995 8:22130836-22130858 GGGGGAAAGGCCGAGGGGCCGGG 0: 1
1: 0
2: 2
3: 53
4: 558
1037819978_1037819998 23 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819998 8:22130842-22130864 AAGGCCGAGGGGCCGGGGAAGGG 0: 1
1: 0
2: 3
3: 37
4: 440
1037819978_1037819996 18 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819996 8:22130837-22130859 GGGGAAAGGCCGAGGGGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 478
1037819978_1037819988 -1 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819988 8:22130818-22130840 GTCGGAGATGGCCGAGTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 105
1037819978_1037819986 -3 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819986 8:22130816-22130838 GGGTCGGAGATGGCCGAGTTGGG 0: 1
1: 0
2: 1
3: 4
4: 75
1037819978_1037819999 24 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819999 8:22130843-22130865 AGGCCGAGGGGCCGGGGAAGGGG 0: 1
1: 0
2: 3
3: 74
4: 739
1037819978_1037819987 -2 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819987 8:22130817-22130839 GGTCGGAGATGGCCGAGTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1037819978_1037820000 25 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037820000 8:22130844-22130866 GGCCGAGGGGCCGGGGAAGGGGG 0: 1
1: 0
2: 7
3: 121
4: 981
1037819978_1037819989 4 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819989 8:22130823-22130845 AGATGGCCGAGTTGGGGGAAAGG 0: 1
1: 0
2: 0
3: 25
4: 256
1037819978_1037819994 16 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819994 8:22130835-22130857 TGGGGGAAAGGCCGAGGGGCCGG 0: 1
1: 0
2: 4
3: 44
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037819978 Original CRISPR CCCGGGGCGCGTGTTCCCCC CGG (reversed) Exonic