ID: 1037819978

View in Genome Browser
Species Human (GRCh38)
Location 8:22130796-22130818
Sequence CCCGGGGCGCGTGTTCCCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037819978_1037820000 25 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037820000 8:22130844-22130866 GGCCGAGGGGCCGGGGAAGGGGG 0: 1
1: 0
2: 7
3: 121
4: 981
1037819978_1037819993 12 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819993 8:22130831-22130853 GAGTTGGGGGAAAGGCCGAGGGG 0: 1
1: 0
2: 2
3: 44
4: 433
1037819978_1037819994 16 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819994 8:22130835-22130857 TGGGGGAAAGGCCGAGGGGCCGG 0: 1
1: 0
2: 4
3: 44
4: 556
1037819978_1037819995 17 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819995 8:22130836-22130858 GGGGGAAAGGCCGAGGGGCCGGG 0: 1
1: 0
2: 2
3: 53
4: 558
1037819978_1037819991 10 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819991 8:22130829-22130851 CCGAGTTGGGGGAAAGGCCGAGG 0: 1
1: 0
2: 0
3: 16
4: 148
1037819978_1037819986 -3 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819986 8:22130816-22130838 GGGTCGGAGATGGCCGAGTTGGG 0: 1
1: 0
2: 1
3: 4
4: 75
1037819978_1037819996 18 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819996 8:22130837-22130859 GGGGAAAGGCCGAGGGGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 478
1037819978_1037819985 -4 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819985 8:22130815-22130837 CGGGTCGGAGATGGCCGAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 126
1037819978_1037819989 4 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819989 8:22130823-22130845 AGATGGCCGAGTTGGGGGAAAGG 0: 1
1: 0
2: 0
3: 25
4: 256
1037819978_1037819999 24 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819999 8:22130843-22130865 AGGCCGAGGGGCCGGGGAAGGGG 0: 1
1: 0
2: 3
3: 74
4: 739
1037819978_1037819992 11 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819992 8:22130830-22130852 CGAGTTGGGGGAAAGGCCGAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1037819978_1037819998 23 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819998 8:22130842-22130864 AAGGCCGAGGGGCCGGGGAAGGG 0: 1
1: 0
2: 3
3: 37
4: 440
1037819978_1037819988 -1 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819988 8:22130818-22130840 GTCGGAGATGGCCGAGTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 105
1037819978_1037819987 -2 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819987 8:22130817-22130839 GGTCGGAGATGGCCGAGTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1037819978_1037819997 22 Left 1037819978 8:22130796-22130818 CCGGGGGGAACACGCGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1037819997 8:22130841-22130863 AAAGGCCGAGGGGCCGGGGAAGG 0: 1
1: 0
2: 4
3: 42
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037819978 Original CRISPR CCCGGGGCGCGTGTTCCCCC CGG (reversed) Exonic
901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG + Intronic
905169071 1:36099101-36099123 CCTGGGGCCCTGGTTCCCCCTGG + Exonic
905169195 1:36099406-36099428 CCCGGGCCTCGGGGTCCCCCTGG - Exonic
910251321 1:85201343-85201365 CCCGGGGCGCGGGTCCCCGGAGG - Intergenic
916750776 1:167721492-167721514 CACGGGGAACGTGTTCCACCTGG + Intronic
921051573 1:211515333-211515355 CCAGGGGCGCGTCTTGGCCCTGG - Intergenic
922416372 1:225427038-225427060 CCCCGGGGGCCTGTTCACCCTGG + Intronic
1064662112 10:17617067-17617089 CCCGCGGCGCGCGTACCCCGCGG + Exonic
1072976726 10:100065352-100065374 CCCGGGTCTCGGGTTCCACCTGG + Exonic
1073057124 10:100710049-100710071 CGCGGGGCGCGGGTTTCTCCCGG - Intergenic
1076373533 10:129969154-129969176 CCCGGGGCAGGTGTCCGCCCCGG + Intergenic
1077095770 11:798399-798421 CCCTGGCCGTGGGTTCCCCCGGG + Exonic
1077110307 11:859331-859353 CCCGGGGTGCGTGTGAGCCCGGG - Intronic
1077110345 11:859463-859485 CCCGGGGTGCGTGTGAGCCCGGG - Intronic
1077110350 11:859480-859502 CCCGGGGTGCGTGTGAGCCCGGG - Intronic
1077442999 11:2577448-2577470 CCCAGGCCGCGTCTTCCCCGAGG - Intronic
1078090741 11:8263096-8263118 CCCGGGGGGCGTGCGGCCCCGGG + Intronic
1081968512 11:47183640-47183662 CCCGGGTTGTGTGTTCCCCACGG - Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084741607 11:71143434-71143456 CCCGATGCGCGGGTTCCCACGGG + Intronic
1097184242 12:57188156-57188178 CCGGGGGTGGGTGCTCCCCCTGG + Intronic
1098161232 12:67649308-67649330 CCCGGGGCGCGTCGTCCGCCCGG - Intronic
1101606167 12:106248451-106248473 CCCGCGGCGCAGGTTCACCCCGG - Intronic
1102457194 12:113078011-113078033 CCCGGGGTGCGCGCTCCGCCGGG - Exonic
1104400091 12:128468170-128468192 CCCGGGGTTGGTGTTCCCTCTGG - Intronic
1105778991 13:23690141-23690163 CCAGGGGAGCGTGTCCCCACAGG - Intergenic
1109915885 13:68984784-68984806 CCTGGGCCGCGTGTCGCCCCTGG - Intergenic
1112344432 13:98577483-98577505 CCCGGGACGCGTTTTCCCAGAGG - Intronic
1113904501 13:113812948-113812970 CCCGGGGCCCGTGACCCACCCGG - Exonic
1117067203 14:52022808-52022830 CCCTGGCCTCGAGTTCCCCCAGG + Intronic
1121367951 14:93332408-93332430 ACGGGGGCGCGTGTTTACCCGGG - Intronic
1122144957 14:99683742-99683764 CCCGGGGCGCCTCCTCCGCCCGG - Intergenic
1122886475 14:104712650-104712672 CCTGGGGCCCGAGTTTCCCCAGG + Intronic
1122893580 14:104744220-104744242 CCCGGGACCCCTGCTCCCCCAGG - Intronic
1123036973 14:105475486-105475508 CCCTTGGCGCCAGTTCCCCCAGG + Intronic
1123706783 15:22956536-22956558 CACGGGGCCTGTGTTCTCCCAGG - Intronic
1125921147 15:43526696-43526718 TCCGGGTTGCGTGTTCCCGCAGG - Exonic
1126725012 15:51622850-51622872 CCCGGCTCGCGCGTTCCCCCCGG - Intergenic
1128315929 15:66659399-66659421 CCAGCGGAGTGTGTTCCCCCTGG + Intronic
1132743363 16:1426905-1426927 GCCGGGGCGCCTGTGTCCCCGGG + Intergenic
1132843568 16:1990073-1990095 CCAGGGGCGCGCGTCCCGCCCGG + Exonic
1137426659 16:48385733-48385755 CCGGGGCCGCGTGACCCCCCCGG + Intronic
1138008710 16:53359102-53359124 CCCGGGGTGCCTGTGCTCCCTGG + Intergenic
1140474074 16:75229914-75229936 CCCAGGCCGCCTGTTCGCCCCGG + Exonic
1142136840 16:88455443-88455465 CCCGGGGCGCCTCCTCCCCATGG + Intronic
1142343932 16:89541995-89542017 TGCGGGGCACGTGCTCCCCCCGG - Intronic
1143321149 17:6070227-6070249 CCCCGCGCGCGTGTTCTCGCGGG + Intronic
1148685057 17:49496350-49496372 CCCCGGGAGCGGGTTCGCCCCGG - Intronic
1151314341 17:73312292-73312314 CCAGGGGCGCGTCTCCCTCCGGG + Intergenic
1152103080 17:78314198-78314220 CCCTGGGCGCGTGCCACCCCCGG + Intergenic
1152363005 17:79840967-79840989 CGCGGGGCTCGTGTTCGCCCAGG + Intergenic
1157747832 18:50151958-50151980 AACGGGGCGGATGTTCCCCCAGG - Intronic
1160839810 19:1141100-1141122 TCCGGGGCGCGTGTTCTCCGGGG - Intronic
1161076938 19:2290390-2290412 CCGGGCGCGCGTGCTCCCCGGGG - Exonic
1161550912 19:4911593-4911615 CCTGGGGCGTGTGGTCCCCGAGG + Intronic
1161844979 19:6707276-6707298 GCGGGAGCACGTGTTCCCCCAGG + Intronic
1163607073 19:18281382-18281404 CCCGGGCCGCTTGTTCCCCGGGG - Exonic
1167661364 19:50797852-50797874 CCTGGGGGGAGTGATCCCCCAGG - Exonic
1168645982 19:58059568-58059590 GGCGGGGCGCGCGTTCCCTCAGG - Intronic
926580951 2:14632741-14632763 GCCGGGGCGCCTGCTCCCACTGG - Exonic
931881951 2:66577544-66577566 CCCGGGACTCGTTTTCCGCCTGG - Intergenic
932144723 2:69307181-69307203 CCCGGGACGGCTGTGCCCCCAGG + Intergenic
942944351 2:181656937-181656959 CCGGGGGCGCCTCTTCCTCCCGG + Exonic
945032916 2:205682168-205682190 CCGGGGGCGCTTCTTCCCCAGGG + Intronic
946622166 2:221572470-221572492 CACGGGGCGCGCGGTCTCCCGGG + Intronic
947144973 2:227056007-227056029 CCTGGGGCACATGGTCCCCCAGG - Exonic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
1172437798 20:34942358-34942380 CCCGGGTCACATGTTGCCCCTGG - Intronic
1175225293 20:57440890-57440912 CCGGGGGGGCGGGTTCCCCTCGG + Intergenic
1175301871 20:57948696-57948718 CCCGGAGCGGGTGTGCCCCGTGG + Intergenic
1179985338 21:44917875-44917897 CCCGGGCTGCGTGTTCTCTCCGG - Intronic
1184073782 22:42163281-42163303 CCTGGGGCGCGTGGTGGCCCAGG + Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185133176 22:49052132-49052154 CCAGGAGCGCGTGTCCCCGCCGG + Intergenic
1185343026 22:50299971-50299993 CCCCGGGCGCGCTTTGCCCCTGG - Intronic
952990322 3:38826066-38826088 CCTGAGGTGCCTGTTCCCCCAGG + Intergenic
953031198 3:39180977-39180999 CCCGCAGGGCGTGTTCCCACCGG - Intergenic
962095218 3:132285846-132285868 CCCTGCGTGCTTGTTCCCCCTGG + Intergenic
962919274 3:139936002-139936024 CCCGGGGAACGTGTACCCTCCGG + Intronic
963077504 3:141360855-141360877 CCAGGGGTGCGTTTGCCCCCTGG - Intronic
967144503 3:186595057-186595079 CCCCTGGCACGTGTTCACCCGGG - Intronic
971352116 4:25863523-25863545 CGCAGGGCGAGTGTGCCCCCTGG + Intronic
973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG + Intronic
987099954 5:14582341-14582363 CCCGGGGCGCGTGGACCCGCGGG + Intronic
1003139145 6:3456731-3456753 CCCGGGGCGCGGGGTCCGGCGGG - Intronic
1003624257 6:7727709-7727731 CCCGGCGCGCGGGTCCCGCCTGG + Intronic
1003869379 6:10390193-10390215 CCCGGGGCGACACTTCCCCCCGG + Intergenic
1004367907 6:15027533-15027555 CCTGGGGCTCCTGTACCCCCTGG + Intergenic
1005830587 6:29667987-29668009 CCAGGGGTCCTTGTTCCCCCAGG - Intronic
1020092708 7:5350288-5350310 CCCGGGGCCCATGTTCCCCTGGG - Intronic
1021969331 7:25951307-25951329 CCCGGGGCGCACGTGACCCCGGG - Intergenic
1022499004 7:30871011-30871033 CCAGGGCCGTGTGTGCCCCCAGG + Intronic
1022499031 7:30871105-30871127 CCAGGGTCGTGTGTGCCCCCAGG + Intronic
1028755067 7:94425150-94425172 CCTGGGGCCCGTGGTCCTCCTGG + Exonic
1034978014 7:155459069-155459091 GCCGGGACGCGTGGTCCCCGCGG - Intronic
1036749399 8:11434458-11434480 CCAGGGGCTCCTGTGCCCCCTGG + Intronic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1048201025 8:132373981-132374003 CCCAGGGTGCATGTTCTCCCGGG + Intronic
1049460945 8:142727496-142727518 CCCGGGCCGCGTGCTGCCCTCGG + Exonic
1057524537 9:95786797-95786819 CCCGGGCCTGGTGTTCCTCCAGG + Intergenic
1059268849 9:113060259-113060281 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059269985 9:113065708-113065730 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059271119 9:113071156-113071178 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059272252 9:113076602-113076624 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059273387 9:113082044-113082066 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1059274523 9:113087490-113087512 CCCGGGGGGCGCCTTCCTCCCGG - Intergenic
1061149101 9:128818847-128818869 CCCGGGCCGCGGGGTCCCCCGGG - Exonic
1061942839 9:133892245-133892267 CCCGGGACACCTGTTCCCACTGG - Intronic
1195378536 X:104250424-104250446 CCCATGGCGCGTGTGCCACCCGG - Exonic
1195378545 X:104250451-104250473 CCCATGGCGCGTGTGCCACCCGG - Exonic
1199699333 X:150364436-150364458 CCCGAGGCGCGTGTTTGCACAGG - Intronic
1200003826 X:153074878-153074900 CCTGGGGTGGGTGTTCCCCCAGG + Exonic
1200068416 X:153515947-153515969 CCTGGGGCGTGTGCTCCTCCGGG - Intergenic