ID: 1037820101

View in Genome Browser
Species Human (GRCh38)
Location 8:22131206-22131228
Sequence CCTGCCGAGAGAGGCTCCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 184}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037820085_1037820101 4 Left 1037820085 8:22131179-22131201 CCCCCTCCCCCCCGCGGCACCCG 0: 1
1: 0
2: 6
3: 84
4: 676
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820095_1037820101 -6 Left 1037820095 8:22131189-22131211 CCCGCGGCACCCGGGCGCCTGCC 0: 1
1: 0
2: 1
3: 20
4: 280
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820094_1037820101 -5 Left 1037820094 8:22131188-22131210 CCCCGCGGCACCCGGGCGCCTGC 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820091_1037820101 -2 Left 1037820091 8:22131185-22131207 CCCCCCCGCGGCACCCGGGCGCC 0: 1
1: 0
2: 2
3: 32
4: 366
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820090_1037820101 1 Left 1037820090 8:22131182-22131204 CCTCCCCCCCGCGGCACCCGGGC 0: 1
1: 0
2: 6
3: 66
4: 534
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820096_1037820101 -7 Left 1037820096 8:22131190-22131212 CCGCGGCACCCGGGCGCCTGCCG 0: 1
1: 0
2: 0
3: 10
4: 244
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820093_1037820101 -4 Left 1037820093 8:22131187-22131209 CCCCCGCGGCACCCGGGCGCCTG 0: 1
1: 0
2: 0
3: 6
4: 215
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820088_1037820101 2 Left 1037820088 8:22131181-22131203 CCCTCCCCCCCGCGGCACCCGGG 0: 1
1: 0
2: 3
3: 24
4: 297
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820083_1037820101 12 Left 1037820083 8:22131171-22131193 CCTTTGTTCCCCCTCCCCCCCGC 0: 1
1: 0
2: 9
3: 79
4: 800
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820082_1037820101 13 Left 1037820082 8:22131170-22131192 CCCTTTGTTCCCCCTCCCCCCCG 0: 1
1: 0
2: 8
3: 39
4: 518
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820092_1037820101 -3 Left 1037820092 8:22131186-22131208 CCCCCCGCGGCACCCGGGCGCCT 0: 1
1: 1
2: 0
3: 12
4: 205
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184
1037820086_1037820101 3 Left 1037820086 8:22131180-22131202 CCCCTCCCCCCCGCGGCACCCGG 0: 1
1: 0
2: 2
3: 36
4: 459
Right 1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037820101 Original CRISPR CCTGCCGAGAGAGGCTCCCC CGG Exonic