ID: 1037820750

View in Genome Browser
Species Human (GRCh38)
Location 8:22133540-22133562
Sequence CCCCCACCAGGCGTTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037820750_1037820760 -1 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820760 8:22133562-22133584 GATGGGGAAGGGGGAATACCAGG No data
1037820750_1037820768 27 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG No data
1037820750_1037820765 22 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820765 8:22133585-22133607 CGAATTCTCCCGGGACCCGCGGG No data
1037820750_1037820761 12 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820761 8:22133575-22133597 GAATACCAGGCGAATTCTCCCGG No data
1037820750_1037820764 21 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820764 8:22133584-22133606 GCGAATTCTCCCGGGACCCGCGG No data
1037820750_1037820759 -10 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820759 8:22133553-22133575 CTGGTGGGGGATGGGGAAGGGGG No data
1037820750_1037820766 23 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820766 8:22133586-22133608 GAATTCTCCCGGGACCCGCGGGG No data
1037820750_1037820762 13 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820762 8:22133576-22133598 AATACCAGGCGAATTCTCCCGGG No data
1037820750_1037820770 29 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820770 8:22133592-22133614 TCCCGGGACCCGCGGGGGTGGGG No data
1037820750_1037820772 30 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820772 8:22133593-22133615 CCCGGGACCCGCGGGGGTGGGGG No data
1037820750_1037820767 24 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820767 8:22133587-22133609 AATTCTCCCGGGACCCGCGGGGG No data
1037820750_1037820769 28 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820769 8:22133591-22133613 CTCCCGGGACCCGCGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037820750 Original CRISPR CCCCCACCAGGCGTTGCCAC AGG (reversed) Intergenic