ID: 1037820757

View in Genome Browser
Species Human (GRCh38)
Location 8:22133552-22133574
Sequence CCCCTTCCCCATCCCCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037820757_1037820775 23 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820775 8:22133598-22133620 GACCCGCGGGGGTGGGGGCAGGG No data
1037820757_1037820778 28 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820778 8:22133603-22133625 GCGGGGGTGGGGGCAGGGTGTGG No data
1037820757_1037820774 22 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820774 8:22133597-22133619 GGACCCGCGGGGGTGGGGGCAGG No data
1037820757_1037820765 10 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820765 8:22133585-22133607 CGAATTCTCCCGGGACCCGCGGG No data
1037820757_1037820767 12 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820767 8:22133587-22133609 AATTCTCCCGGGACCCGCGGGGG No data
1037820757_1037820766 11 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820766 8:22133586-22133608 GAATTCTCCCGGGACCCGCGGGG No data
1037820757_1037820770 17 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820770 8:22133592-22133614 TCCCGGGACCCGCGGGGGTGGGG No data
1037820757_1037820780 30 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820780 8:22133605-22133627 GGGGGTGGGGGCAGGGTGTGGGG No data
1037820757_1037820769 16 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820769 8:22133591-22133613 CTCCCGGGACCCGCGGGGGTGGG No data
1037820757_1037820772 18 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820772 8:22133593-22133615 CCCGGGACCCGCGGGGGTGGGGG No data
1037820757_1037820761 0 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820761 8:22133575-22133597 GAATACCAGGCGAATTCTCCCGG No data
1037820757_1037820779 29 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820779 8:22133604-22133626 CGGGGGTGGGGGCAGGGTGTGGG No data
1037820757_1037820764 9 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820764 8:22133584-22133606 GCGAATTCTCCCGGGACCCGCGG No data
1037820757_1037820768 15 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG No data
1037820757_1037820762 1 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820762 8:22133576-22133598 AATACCAGGCGAATTCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037820757 Original CRISPR CCCCTTCCCCATCCCCCACC AGG (reversed) Intergenic