ID: 1037820768

View in Genome Browser
Species Human (GRCh38)
Location 8:22133590-22133612
Sequence TCTCCCGGGACCCGCGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037820757_1037820768 15 Left 1037820757 8:22133552-22133574 CCTGGTGGGGGATGGGGAAGGGG No data
Right 1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG No data
1037820748_1037820768 28 Left 1037820748 8:22133539-22133561 CCCTGTGGCAACGCCTGGTGGGG No data
Right 1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG No data
1037820750_1037820768 27 Left 1037820750 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG No data
Right 1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037820768 Original CRISPR TCTCCCGGGACCCGCGGGGG TGG Intergenic