ID: 1037821593

View in Genome Browser
Species Human (GRCh38)
Location 8:22137726-22137748
Sequence CAGTGGGAGCACAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037821593_1037821604 25 Left 1037821593 8:22137726-22137748 CCCTCCTGCCTGTGCTCCCACTG No data
Right 1037821604 8:22137774-22137796 CCAAGGCCTAACTGAAGTTTCGG No data
1037821593_1037821600 8 Left 1037821593 8:22137726-22137748 CCCTCCTGCCTGTGCTCCCACTG No data
Right 1037821600 8:22137757-22137779 ATAGCTGCACCTTCCTGCCAAGG No data
1037821593_1037821605 26 Left 1037821593 8:22137726-22137748 CCCTCCTGCCTGTGCTCCCACTG No data
Right 1037821605 8:22137775-22137797 CAAGGCCTAACTGAAGTTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037821593 Original CRISPR CAGTGGGAGCACAGGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr