ID: 1037824988

View in Genome Browser
Species Human (GRCh38)
Location 8:22155659-22155681
Sequence ATTGCCTCTTGGGGCACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037824973_1037824988 18 Left 1037824973 8:22155618-22155640 CCTCCCAAATTCACTGCCTGCCT 0: 1
1: 0
2: 3
3: 21
4: 333
Right 1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG 0: 1
1: 0
2: 0
3: 8
4: 103
1037824972_1037824988 24 Left 1037824972 8:22155612-22155634 CCTTCTCCTCCCAAATTCACTGC 0: 1
1: 1
2: 3
3: 43
4: 413
Right 1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG 0: 1
1: 0
2: 0
3: 8
4: 103
1037824971_1037824988 25 Left 1037824971 8:22155611-22155633 CCCTTCTCCTCCCAAATTCACTG 0: 1
1: 0
2: 3
3: 44
4: 402
Right 1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG 0: 1
1: 0
2: 0
3: 8
4: 103
1037824978_1037824988 2 Left 1037824978 8:22155634-22155656 CCTGCCTTCACCAGGGTCCTCCC 0: 1
1: 0
2: 15
3: 205
4: 520
Right 1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG 0: 1
1: 0
2: 0
3: 8
4: 103
1037824979_1037824988 -2 Left 1037824979 8:22155638-22155660 CCTTCACCAGGGTCCTCCCCTAT 0: 1
1: 0
2: 2
3: 19
4: 212
Right 1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG 0: 1
1: 0
2: 0
3: 8
4: 103
1037824974_1037824988 15 Left 1037824974 8:22155621-22155643 CCCAAATTCACTGCCTGCCTTCA 0: 1
1: 0
2: 2
3: 29
4: 287
Right 1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG 0: 1
1: 0
2: 0
3: 8
4: 103
1037824975_1037824988 14 Left 1037824975 8:22155622-22155644 CCAAATTCACTGCCTGCCTTCAC 0: 1
1: 0
2: 2
3: 29
4: 288
Right 1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG 0: 1
1: 0
2: 0
3: 8
4: 103
1037824980_1037824988 -8 Left 1037824980 8:22155644-22155666 CCAGGGTCCTCCCCTATTGCCTC 0: 1
1: 0
2: 2
3: 18
4: 192
Right 1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037824988 Original CRISPR ATTGCCTCTTGGGGCACCCA TGG Intronic
900361711 1:2292374-2292396 AGTCCTTCATGGGGCACCCAGGG - Intronic
900413422 1:2524024-2524046 GTTTCCTCTTTGGGCACCAATGG + Intronic
900470967 1:2854786-2854808 CTTGCCTCTGGGAGCACCCACGG + Intergenic
901531072 1:9852847-9852869 ATTCCCTCCTGGGGCATCCAGGG - Intronic
916522918 1:165581452-165581474 ATTGCTTTTTGGGGAACCCATGG - Intergenic
918081174 1:181208873-181208895 AGTGCCTATTGTGGCACCAAAGG - Intergenic
923076043 1:230609306-230609328 ATTGCCTCTGGGAGCACCAGAGG - Intergenic
923083918 1:230687244-230687266 GTTCTCTCTTGGGGTACCCACGG - Intronic
1062926234 10:1317701-1317723 ATGGGCTTTTGGGGGACCCAGGG - Intronic
1067012199 10:42724759-42724781 CTGGCCTCCTGGGGCACCCCTGG + Intergenic
1067044955 10:42980295-42980317 ACTGTCTGTTGGGACACCCAGGG + Intergenic
1067225541 10:44373718-44373740 AGTGCCTCTTGGGACAGCCGAGG - Intronic
1067311396 10:45117134-45117156 CTGGCCTCCTGGGGCACCCCTGG - Intergenic
1068934408 10:62622104-62622126 ATTGCCTATGGGGGTGCCCAAGG + Intronic
1073477340 10:103762932-103762954 ATTGGCTCTTGGGGGACAGATGG - Intronic
1076868469 10:133181180-133181202 GATGCCACATGGGGCACCCAGGG + Intronic
1077707761 11:4504262-4504284 ATTGGCTCTTGAGGCCCCCCAGG + Intergenic
1083840123 11:65299506-65299528 AGGGCCTCGAGGGGCACCCAAGG + Intronic
1091375303 12:21338-21360 ATTCACCCTTGGGGCACCCCCGG - Intergenic
1091405157 12:204299-204321 GATGCCTCTTGGGGCAACCATGG - Intronic
1092356378 12:7798864-7798886 CATGCCTCCTGGGGCCCCCATGG + Exonic
1092369608 12:7905821-7905843 CATGCCTCCTGGGGCCCCCATGG + Intergenic
1095565671 12:43621081-43621103 AATGCCTTTTGGGCAACCCAGGG + Intergenic
1096028113 12:48385994-48386016 ATTTTTTCTTGGGGCACCAATGG - Intergenic
1100984059 12:100188248-100188270 ATTTCTTCCTGGTGCACCCAGGG + Intergenic
1101718128 12:107328964-107328986 AGTGACTCATGGGGCAGCCAGGG - Intronic
1102718885 12:114999244-114999266 ATTGCCGCCTGGGGACCCCAGGG + Intergenic
1102885331 12:116517553-116517575 ATCACCTCTCGGGGCACACAGGG + Intergenic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1109746309 13:66627566-66627588 CTGGCCTCTAGGGGCTCCCAGGG + Intronic
1112472425 13:99701107-99701129 GTTGCCCCTGAGGGCACCCAAGG - Intronic
1114464940 14:22915055-22915077 ATGGACTCTTAGGGCAACCAAGG - Intronic
1121332144 14:93056300-93056322 AAGGCCTCTGGGGTCACCCAAGG + Intronic
1128690222 15:69719025-69719047 GCTGCCTCTTGAGCCACCCAGGG + Intergenic
1132868495 16:2105113-2105135 GGTGCCTCTCGGGGGACCCAGGG - Intronic
1134523094 16:14927549-14927571 GGTGCCTCTCGGGGGACCCAGGG + Intronic
1134549536 16:15132509-15132531 GGTGCCTCTCGGGGGACCCAGGG - Intronic
1134710761 16:16326200-16326222 GGTGCCTCTCGGGGGACCCAGGG + Intergenic
1134718932 16:16370488-16370510 GGTGCCTCTCGGGGGACCCAGGG + Intergenic
1134948840 16:18342445-18342467 GGTGCCTCTCGGGGGACCCAGGG - Intergenic
1134955824 16:18381671-18381693 GGTGCCTCTCGGGGGACCCAGGG - Intergenic
1138653930 16:58479426-58479448 ACTGCCTCTTAGTGCACACATGG + Intronic
1139854240 16:69968052-69968074 ATGGCTTCTTAGGTCACCCAGGG + Intergenic
1139883220 16:70190966-70190988 ATGGCTTCTTAGGTCACCCAGGG + Intergenic
1140369287 16:74404555-74404577 ATGGCTTCTTAGGTCACCCAGGG - Intergenic
1140893345 16:79304065-79304087 ATTGCATCTTGGGTCCCACAAGG - Intergenic
1147533578 17:41302666-41302688 ACAGCCACTTGGGGCACCAATGG + Exonic
1148070269 17:44904628-44904650 ATGGGCACCTGGGGCACCCAGGG - Exonic
1149012680 17:51873669-51873691 ATTGCCTCTCAGCACACCCATGG - Intronic
1149491987 17:57091624-57091646 ATTGCCTGCTGGGGCAACAAGGG - Intronic
1149555130 17:57568195-57568217 AATGCCTCTTGGTCCACACAAGG + Intronic
1151566708 17:74902555-74902577 TCTACCTCTTGGGGCACCTAGGG - Intergenic
1154297555 18:13163425-13163447 ATTGCCTCATGGAGGACCAAAGG - Intergenic
1155183175 18:23365859-23365881 ATTGCCTCTTGGGACAGGCTTGG + Intronic
1163452242 19:17385285-17385307 TTTGCCTCTCTGGGCATCCAGGG + Intergenic
931996315 2:67842441-67842463 TTTGCCTTTTGCTGCACCCATGG + Intergenic
934573402 2:95385582-95385604 CTAGCCTCTTGGGGCACACGGGG - Exonic
936092995 2:109512774-109512796 CTTAGGTCTTGGGGCACCCAGGG - Intergenic
937284321 2:120740816-120740838 ATTCCCTCTTTGGGCAGCCGAGG + Intronic
937936393 2:127249123-127249145 ATGGCCTCTTGGGCCAGCTATGG + Intergenic
938079000 2:128359323-128359345 ATTGCCTCTTCCTGCACCCAGGG + Intergenic
938104439 2:128520473-128520495 ACTTCATCTTGGGGCACACAGGG + Intergenic
941409844 2:165140954-165140976 ATTGCGTCTTGGGGAAAACAGGG + Exonic
1169669386 20:8078795-8078817 AATGCCTGTTGGATCACCCATGG + Intergenic
1178497450 21:33099328-33099350 TGTGCTTCTTGGGGCACCCTTGG + Intergenic
1178747461 21:35266734-35266756 CTTGCATCTTGGGGCTTCCATGG + Intronic
1179251102 21:39672229-39672251 CTTACCTCTTCGGGGACCCAGGG - Exonic
1179953745 21:44726641-44726663 ATTGCGTTTTGTGGCACTCAGGG + Intergenic
1179962928 21:44780925-44780947 AGTGCCTTATGGAGCACCCAGGG + Intronic
1180180142 21:46115104-46115126 TTTGCCACTTGGGGCAGCCTTGG + Intronic
1180342684 22:11630287-11630309 CTTGCCTCTTGGCGCCCCCTCGG + Intergenic
1181623955 22:24109673-24109695 CTGGCCTCTTGGGGAACACAAGG - Intronic
1183499226 22:38168469-38168491 GTTGCCTCTTGGGGCATGCTGGG - Intronic
1185303947 22:50101829-50101851 ATTTCATCTTGGGGATCCCAGGG - Intronic
953481141 3:43253559-43253581 AGTGCATCTTGGGTGACCCATGG + Intergenic
955083595 3:55680423-55680445 AATGCCTCTTGGGGGATCCATGG + Intronic
957225155 3:77433732-77433754 ATTTCCTCTTGGCTCACTCATGG + Intronic
963391819 3:144674365-144674387 ATTGCCTCTTGGTTCACAGATGG - Intergenic
971900507 4:32651956-32651978 ATTGGCTCTTGTGGAACCGAAGG + Intergenic
974245323 4:59307831-59307853 ATTGTCTCTTGGGGAATCAAAGG - Intergenic
984823432 4:183904642-183904664 ACTACCTCTTGGGATACCCAGGG - Intronic
984887841 4:184466612-184466634 ATTGCCTTTGGAGGCAACCACGG - Intronic
988670875 5:33379949-33379971 AGTGGCTCTTGGGGCAAGCAAGG - Intergenic
992078670 5:73214740-73214762 AATGCCTCTTGGCTCACCCAAGG + Intergenic
1002382777 5:178842124-178842146 GTTGCCTTTTGGGGGACCCCAGG + Intergenic
1002387278 5:178877682-178877704 ATTGCCACTTTGGCCACCAAAGG + Intronic
1003258451 6:4494439-4494461 CTTGCATCTAGGGGCAGCCATGG - Intergenic
1008057617 6:46961646-46961668 TGTGCCTCTTGGGGCAGGCACGG - Intergenic
1011746911 6:90415150-90415172 ATTAGATGTTGGGGCACCCATGG - Intergenic
1013190040 6:107794813-107794835 ATTCCTTCTTGGGGCACTGAGGG + Intronic
1019486480 7:1291752-1291774 AATGACTCTATGGGCACCCAGGG + Intergenic
1021178682 7:17480688-17480710 ATTGCCTCTTGGGGAAACATAGG + Intergenic
1023790443 7:43749665-43749687 GGTGCCTCTTCTGGCACCCATGG - Intergenic
1026931436 7:74224889-74224911 CTGCCCTCTTGGAGCACCCATGG - Intronic
1029154347 7:98504372-98504394 ATCGGCTCTTGGGGCCCCCCAGG + Intergenic
1034574865 7:151988087-151988109 AATGGCTCTTGGGGCAGCCCTGG - Intronic
1036328665 8:7801462-7801484 CTTGGCTCTTGGGGCAGGCAAGG + Intergenic
1037824988 8:22155659-22155681 ATTGCCTCTTGGGGCACCCATGG + Intronic
1039382440 8:37098980-37099002 AATGCCCTTTGAGGCACCCAGGG + Intergenic
1039858243 8:41434830-41434852 ATGGGCTTCTGGGGCACCCAGGG + Intergenic
1045602863 8:103737611-103737633 ACTTCCTATTGGGGCACACAGGG + Intronic
1051812510 9:21066324-21066346 ATTGCCTCTGGTGGAACCAAGGG + Intergenic
1058324380 9:103677436-103677458 ATTCCTTCTTGGGGCACCAAGGG + Intergenic
1059434281 9:114266879-114266901 ATTGCCTCTTTGGGCATCACTGG + Intronic
1061334092 9:129918460-129918482 ATTGACGCTTGTGGCTCCCACGG - Intronic
1186999315 X:15158931-15158953 ATTTCCTCTTAGGACAACCAAGG + Intergenic
1187516248 X:19974041-19974063 ATTGCCCCTTGGTACACTCAGGG + Intergenic
1187757629 X:22545141-22545163 ACTGCCTTTTGGGGAACCAAGGG + Intergenic
1191721168 X:64230248-64230270 ATATCCTCTTGGGACACACAAGG + Intronic
1195318287 X:103699889-103699911 TTTGGCTCTTGAGGTACCCATGG + Intergenic
1198507264 X:137313018-137313040 TCAGCCTCTTGGGGCACACAAGG + Intergenic
1198521001 X:137452305-137452327 ATAGCCTCTTTGTGCACACATGG + Intergenic