ID: 1037825295

View in Genome Browser
Species Human (GRCh38)
Location 8:22156802-22156824
Sequence GGACTGCGGCGCGGGCGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 8, 3: 41, 4: 486}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037825284_1037825295 4 Left 1037825284 8:22156775-22156797 CCGGGGCTGACCGCGCCGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 158
Right 1037825295 8:22156802-22156824 GGACTGCGGCGCGGGCGGCGGGG 0: 1
1: 0
2: 8
3: 41
4: 486
1037825281_1037825295 10 Left 1037825281 8:22156769-22156791 CCGCAGCCGGGGCTGACCGCGCC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1037825295 8:22156802-22156824 GGACTGCGGCGCGGGCGGCGGGG 0: 1
1: 0
2: 8
3: 41
4: 486
1037825287_1037825295 -6 Left 1037825287 8:22156785-22156807 CCGCGCCGGGTGGCTGCGGACTG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1037825295 8:22156802-22156824 GGACTGCGGCGCGGGCGGCGGGG 0: 1
1: 0
2: 8
3: 41
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037825295 Original CRISPR GGACTGCGGCGCGGGCGGCG GGG Exonic
900101634 1:964541-964563 GGGCTGCGGGGAGGGGGGCGCGG + Intronic
900121783 1:1051397-1051419 GGCCTCCGGGGCGGGCGGGGTGG + Intronic
900201251 1:1407600-1407622 CGGGTGCGGCGCGGGCGGGGAGG + Intergenic
900242450 1:1623530-1623552 GGACGGCGGCGAGGGCGGCGTGG + Exonic
900243277 1:1626772-1626794 GGGCAGCGGCGCTAGCGGCGGGG - Intronic
900349671 1:2228502-2228524 GGGCGGCGGCGGGCGCGGCGCGG + Intergenic
901019763 1:6249708-6249730 GGGCGGCGGCGCGGGCTGCCGGG + Exonic
901086711 1:6615127-6615149 GGCCGGGGGGGCGGGCGGCGTGG + Intronic
901199167 1:7457042-7457064 GCACGGCGGCGCAGGGGGCGGGG - Intronic
901381681 1:8878689-8878711 GGAAGTCGGCGCGGGCGGCGCGG - Exonic
901433891 1:9234743-9234765 GGCCGGGGGCGCGCGCGGCGGGG - Intergenic
901433992 1:9235076-9235098 GGGCGGCGGCGGGGCCGGCGGGG - Intronic
901836349 1:11926301-11926323 GCAGTGAGGCGCGGGCGGCCGGG - Exonic
902044178 1:13513054-13513076 GGAGCGCAGCGCGGGCAGCGCGG + Exonic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902476984 1:16693475-16693497 GGCTTGCGGCGCGGACAGCGCGG + Intergenic
902600948 1:17539864-17539886 GGCCTGCGGAGCTGGAGGCGCGG + Exonic
903263392 1:22143008-22143030 GGGCCGGGGCGCGCGCGGCGGGG + Intronic
903573415 1:24322583-24322605 CGGCGGCGGCCCGGGCGGCGCGG + Intronic
904618189 1:31761022-31761044 GCGGTGCCGCGCGGGCGGCGGGG + Intronic
905145294 1:35883280-35883302 GGGCGGCGGCGCGAGCGGCCGGG + Exonic
905173988 1:36125093-36125115 CGAGGGCGGCCCGGGCGGCGAGG + Exonic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
906102625 1:43272860-43272882 AGGCTGTGGCGCGGGCGGCGTGG + Exonic
906481697 1:46203502-46203524 GGGCTGCTCCGCGGGCTGCGAGG + Exonic
906627132 1:47334239-47334261 CCACTGCCACGCGGGCGGCGCGG - Intronic
906637109 1:47416944-47416966 GAACAGACGCGCGGGCGGCGAGG - Exonic
907051097 1:51330395-51330417 GCCCGGGGGCGCGGGCGGCGCGG - Intronic
907069182 1:51518938-51518960 GGAGGGCGGCGAGGGCCGCGCGG + Intronic
907188989 1:52633259-52633281 GGCAGGCGGGGCGGGCGGCGGGG - Intergenic
909475246 1:76074685-76074707 GGGCCGCGGCTCGGGGGGCGGGG + Intergenic
912301953 1:108526923-108526945 GGGCTGGGGCGGGGGCGGGGGGG - Intergenic
912401468 1:109397455-109397477 GGGCTGCGGCCCGGGGGACGCGG + Intronic
913144496 1:115976448-115976470 GGGCGCCTGCGCGGGCGGCGGGG - Intergenic
914241997 1:145858710-145858732 GGGCTGAGGCGCAGGGGGCGGGG - Intronic
915348291 1:155209065-155209087 GGACTGGGCCGCGGGCCTCGGGG - Exonic
917291617 1:173477266-173477288 GGACTGGGGCGGCGGGGGCGGGG - Exonic
920002254 1:202808009-202808031 GGCCCGAGGCGCGGGGGGCGGGG - Intronic
920305622 1:205016392-205016414 GGACTATGGCGAGGGTGGCGAGG + Exonic
920482206 1:206333479-206333501 GGTCTCTGGTGCGGGCGGCGCGG + Intronic
920556635 1:206909357-206909379 GGATCGCGGCGGCGGCGGCGCGG + Intronic
920704900 1:208243848-208243870 GGACTGAGGGGCGCGCGGAGCGG - Exonic
921029701 1:211326764-211326786 GGGCCGGGGCGCGGGCGGAGGGG - Intronic
922539411 1:226407783-226407805 GGGCCGCTGTGCGGGCGGCGGGG - Intronic
922821409 1:228487925-228487947 GGACCGGGGCGGGGGCGGAGAGG - Intronic
922958521 1:229625736-229625758 GGGGTGGGGCGCGGGAGGCGGGG - Intronic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923372741 1:233328704-233328726 GGGATGCGGCGCGCGCGGCGGGG - Exonic
923400783 1:233614081-233614103 GGGCGGGGGCGGGGGCGGCGGGG + Exonic
923506505 1:234609902-234609924 GGAGTGCGGGGCGGGGGGCGGGG + Intergenic
924917633 1:248590197-248590219 GCACTGGGGCTCCGGCGGCGCGG - Intergenic
1062982424 10:1736790-1736812 GAAGTGGGGCGAGGGCGGCGAGG - Intronic
1063115129 10:3067490-3067512 GGGCGGGGGCGCGGGCGGGGCGG + Intronic
1063458447 10:6201405-6201427 AGAGGGCGGCGCGGGGGGCGGGG + Intronic
1064764755 10:18659555-18659577 CCACCGCGGCGCGGGCTGCGCGG - Exonic
1065099098 10:22316302-22316324 TGGCGGCGGCGCGGGCTGCGGGG - Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1066370416 10:34814847-34814869 GGCCGGGGGCGCGGGCGGGGAGG - Intronic
1068560804 10:58512842-58512864 GGATGGAGGCGCGGGCAGCGCGG + Intergenic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1068954017 10:62805496-62805518 GAACTGCTGCTCGGGCGGCAAGG - Exonic
1069664486 10:70145656-70145678 GAAGCGCGTCGCGGGCGGCGCGG + Exonic
1071309412 10:84328673-84328695 TTGCTGCGGCTCGGGCGGCGGGG + Exonic
1073147866 10:101292239-101292261 AGACTTCGGCGCGGCCCGCGTGG - Intergenic
1076764352 10:132624997-132625019 GGACTGTGGCGTGGGCAGGGTGG - Intronic
1076765491 10:132630791-132630813 GGGAGGCGGCGGGGGCGGCGGGG + Intronic
1076985994 11:236401-236423 GGGCTGGGGCGCCGGGGGCGGGG - Exonic
1076986014 11:236440-236462 GGACCGGGGCGCCGGGGGCGGGG - Intronic
1077008542 11:370033-370055 CGCGGGCGGCGCGGGCGGCGGGG + Intronic
1077097567 11:805417-805439 GCGCTGCTGCGCGGGCGGCTCGG - Intronic
1077098468 11:810091-810113 GGGATGCGGGGTGGGCGGCGGGG + Intronic
1078316118 11:10294327-10294349 GGACTGCTGCGCTGGGGGAGTGG + Intergenic
1078334088 11:10450603-10450625 GGGCTGCGGCGCGGGCCCCGCGG + Intronic
1078679554 11:13463051-13463073 GGAACTCGGCGGGGGCGGCGCGG - Intronic
1079308765 11:19346439-19346461 GGGCTAGGGCGCGGGCGGGGAGG + Intergenic
1080458436 11:32434932-32434954 GGAGTGAGGCGGCGGCGGCGGGG + Exonic
1080606480 11:33869140-33869162 GGACTGGGCGGCGGGCGGCAGGG - Intronic
1080902661 11:36510365-36510387 GGACTGTGGCGCGGGCCGGGCGG + Intergenic
1081872995 11:46391682-46391704 GGCCGGCGGGGCGGGCGGCCGGG + Intergenic
1081938136 11:46918593-46918615 GGGCTGCGGCGCGGGGGGCGGGG - Exonic
1082029506 11:47594264-47594286 GCGCTGCGGCAGGGGCGGCGGGG + Exonic
1082076752 11:47980917-47980939 AGCCGGCGGCGCGGGAGGCGCGG + Exonic
1082807296 11:57459290-57459312 GAGCCGCGGCGCGGGCAGCGGGG + Intergenic
1083477424 11:62923227-62923249 CGGCTGCGGCTTGGGCGGCGCGG + Intergenic
1083885771 11:65572837-65572859 CGTCCGGGGCGCGGGCGGCGCGG - Exonic
1083999583 11:66288915-66288937 GGGGCGCGGCGCGGCCGGCGGGG - Intronic
1084175558 11:67420611-67420633 GGTGTGCGGCGTGGGCCGCGGGG + Exonic
1084301658 11:68256450-68256472 GGACAGCGGCGGGGGAGGAGCGG - Intergenic
1084968111 11:72754926-72754948 GATGGGCGGCGCGGGCGGCGAGG - Exonic
1088648442 11:111937116-111937138 GTGCTGCGGCCCGGGCGGGGGGG + Intronic
1089556245 11:119317223-119317245 GGGCTGCGGCGCGCGGGGCGGGG - Intronic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090832413 11:130428476-130428498 GGGCGGCGGCGCGGGAGGAGCGG - Exonic
1091396024 12:154646-154668 GGACTGTGGTGGGGGCGGCATGG - Intronic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091550375 12:1531206-1531228 GGTCGGCGGCGCAGGCGGGGCGG + Intronic
1091558669 12:1594415-1594437 GCGCGGCGGCGCGGGCGGAGCGG - Intronic
1092239579 12:6828665-6828687 GGATTGCGGGGCGAGCTGCGCGG + Exonic
1093894682 12:24562729-24562751 GGGGTGCGGCGGGGGCGGGGGGG + Intergenic
1095703770 12:45216579-45216601 GGGCTGAGGCGCGGGGCGCGTGG + Intronic
1095814449 12:46406235-46406257 GGAGTGGGGGGTGGGCGGCGTGG + Intergenic
1096178601 12:49538889-49538911 GGACCTCGGCGGGGGCGGGGAGG - Intergenic
1096741562 12:53697376-53697398 GCACAGCGGCGTGGGGGGCGCGG - Intergenic
1097155103 12:57006554-57006576 GCGCTGCGGGCCGGGCGGCGGGG - Intergenic
1098416823 12:70243660-70243682 GGAGAGCGGAGCGGGCGGGGAGG + Intronic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1099713722 12:86264458-86264480 GGGCTGCAGCGGGGGAGGCGGGG + Intronic
1101371943 12:104138299-104138321 GGGCGGGCGCGCGGGCGGCGCGG - Intergenic
1101371973 12:104138358-104138380 GGACTGGGCCGGGGGCGGGGCGG - Intergenic
1101640377 12:106582605-106582627 GGAGGGGGGCGCGGGCGGGGGGG - Intronic
1101970620 12:109309753-109309775 GGGCTGCGGAGCGGGGCGCGGGG + Intergenic
1102101324 12:110281151-110281173 CCAGCGCGGCGCGGGCGGCGCGG - Intronic
1102151022 12:110689181-110689203 GGACGGGGGCGGGGGCGGCCCGG - Intronic
1102278159 12:111598712-111598734 GGACGGCGGCGCGGGCCGCGGGG + Intronic
1102571661 12:113830564-113830586 GGGCTGCGGGGCGGGGGGGGGGG + Intronic
1102913795 12:116738013-116738035 AGACTGGGCTGCGGGCGGCGGGG - Exonic
1103527835 12:121579495-121579517 GCACTGGCGGGCGGGCGGCGGGG - Intronic
1103534779 12:121626869-121626891 GGACGGCGGCGGTGGCGGGGCGG - Exonic
1103623697 12:122203890-122203912 GGACCGGGGAGCGGGCCGCGGGG - Intronic
1103764551 12:123271332-123271354 GGGGTGCGGGGCGGGCGGCCCGG - Intronic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1104882827 12:132084327-132084349 CGACAGCGGACCGGGCGGCGAGG - Exonic
1104904798 12:132207451-132207473 GGACTGCTGGGCGGTCTGCGAGG + Intronic
1105295675 13:19086341-19086363 GGACTGGGGCGGGGGCGGGGAGG - Intergenic
1105512169 13:21060736-21060758 GGACGACGGGGCGGCCGGCGGGG + Intronic
1105525698 13:21176319-21176341 GGGGTGCGCCGCGGGCGGAGGGG - Intronic
1105801081 13:23903719-23903741 GGGCGGAGGCGCGGGAGGCGGGG - Intergenic
1105850301 13:24328333-24328355 GGACCGCGGCAGAGGCGGCGCGG - Intergenic
1105943442 13:25170785-25170807 GCGCTGGGGCGCGGTCGGCGGGG + Exonic
1105943551 13:25171217-25171239 CGACAGCGGCGGGGGCGGCGGGG - Exonic
1105964526 13:25372321-25372343 GGCCCGGGGCGGGGGCGGCGCGG + Intronic
1106517130 13:30465291-30465313 GGCCAGCCGGGCGGGCGGCGGGG - Intronic
1106517169 13:30465412-30465434 GGAGCGCGGCCGGGGCGGCGGGG - Intronic
1107058429 13:36130973-36130995 GAACTGCGGGCGGGGCGGCGGGG + Intronic
1107467805 13:40665817-40665839 CGACAGCGGCCCGGGCGGCGGGG + Exonic
1107605212 13:42049162-42049184 GGCCTGGGGCGCGGGCGGGGCGG + Intronic
1110119633 13:71865880-71865902 GGGAAGGGGCGCGGGCGGCGGGG + Intronic
1110219627 13:73059374-73059396 GTCCTGCGGCGCCGGCGGCTGGG - Exonic
1112333709 13:98497140-98497162 GGACTGTGCCGCGGGCAGGGAGG - Intronic
1112503071 13:99957049-99957071 GGCGCGGGGCGCGGGCGGCGGGG - Intergenic
1112506992 13:99981406-99981428 TGACCGCGGCGGGGGCGCCGGGG - Intergenic
1112507857 13:99985577-99985599 CGGCGGCGGGGCGGGCGGCGGGG + Exonic
1113312032 13:109140990-109141012 GGGCGGGGGCGGGGGCGGCGTGG - Exonic
1113413604 13:110110984-110111006 GGGCTGCGTGGCGGGCTGCGTGG + Intergenic
1113542016 13:111115910-111115932 GAGGGGCGGCGCGGGCGGCGGGG + Intronic
1113602999 13:111584323-111584345 GGACTGGGGCGGTGGCAGCGGGG - Intergenic
1113656867 13:112072927-112072949 GGACAGCGGCGCGGTGTGCGGGG - Intergenic
1113779720 13:112969172-112969194 GCGCTGCGCCGCGGGGGGCGGGG - Intronic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1116895514 14:50311969-50311991 GGGCAGCAGCGCAGGCGGCGGGG + Intronic
1117899072 14:60514889-60514911 GGTCTGTGGAGCGGCCGGCGGGG + Intronic
1118621670 14:67619821-67619843 GGTTGGAGGCGCGGGCGGCGGGG + Exonic
1118916211 14:70108809-70108831 GGACTGTGGCTAGGGCGGAGAGG - Intronic
1118971673 14:70642546-70642568 GGACCGCGGCGCGGGGGGCGCGG - Intronic
1119310795 14:73644870-73644892 GGACTGCGTGGCGGCCGCCGGGG - Intronic
1119759659 14:77141547-77141569 GCAGTGCGGCGGCGGCGGCGCGG - Intronic
1121050430 14:90816311-90816333 GGCCTGCGGGGCGGGCGGCCGGG - Exonic
1121453721 14:94025601-94025623 AGAGTGGGGCGCGGGGGGCGGGG + Intergenic
1122065993 14:99174885-99174907 GGACGCGGGCGCGGGCGGCGCGG - Exonic
1122162236 14:99793157-99793179 GGAGCGCGGCCCGGGCGGCCTGG - Intronic
1122409712 14:101519653-101519675 GGAGGGCGGCGAGGGAGGCGCGG + Intergenic
1122409968 14:101520897-101520919 GGGCTGCGGCTAGGGCTGCGTGG - Intergenic
1122454036 14:101835736-101835758 GGACGGCTGTGCAGGCGGCGTGG - Intronic
1122582000 14:102777178-102777200 GGCCCGCGGGGCGCGCGGCGGGG + Intergenic
1122602457 14:102928500-102928522 GGACTGTGGCGCGGGTGAGGCGG + Exonic
1122620963 14:103057476-103057498 AGTCTGCGGCGGCGGCGGCGGGG - Intergenic
1122688806 14:103522133-103522155 GGGCTGCGTGGCGGGCGACGAGG - Exonic
1122947721 14:105020824-105020846 GGAGGGCGGCGAGGGCGCCGCGG + Intronic
1123023143 14:105411551-105411573 GGACTGAGTCGAGGGAGGCGAGG - Intronic
1124652325 15:31483266-31483288 GCGGCGCGGCGCGGGCGGCGAGG - Exonic
1125180672 15:36878610-36878632 GGAGGCGGGCGCGGGCGGCGGGG + Intergenic
1125612105 15:40978571-40978593 GGACTGAGGTGTGGGCGGCTTGG - Intergenic
1128078238 15:64841634-64841656 GGGCTGCGGCGGGGGAGGAGAGG - Intergenic
1129162238 15:73753212-73753234 CGGCCGGGGCGCGGGCGGCGCGG - Intergenic
1129230202 15:74192843-74192865 GGACTGTGGTGCAGGGGGCGGGG - Intronic
1129710992 15:77820124-77820146 GGAGAGCGGAGGGGGCGGCGGGG - Intronic
1129752793 15:78077604-78077626 GGAGGGCGGCGGCGGCGGCGAGG - Exonic
1130967106 15:88705594-88705616 CGCCTGCGGAGGGGGCGGCGTGG - Intergenic
1131475398 15:92734255-92734277 GGAGAGCGGCGGCGGCGGCGCGG - Intronic
1132426769 15:101724428-101724450 CGACTGCGGCGAGGGCGACGCGG + Exonic
1132551368 16:555129-555151 GGGCTGGGGTGCGGCCGGCGCGG + Intergenic
1132613222 16:828040-828062 GGCCTGGGGCGCGGGCAGCCAGG + Intergenic
1132719805 16:1309969-1309991 GGGCTGCGGCCCGAGCGGCCGGG + Intronic
1132724809 16:1334014-1334036 GCACTGCGGAGCGGACGGGGAGG + Intronic
1132734742 16:1379758-1379780 GGAGGGCAGCGCGGGGGGCGTGG - Intronic
1132978347 16:2721388-2721410 GGGGCGCGGCGCGGGCGGCCAGG + Intergenic
1133732416 16:8589104-8589126 GGCCTGCGGAGAGGGCGGCTGGG - Intronic
1135743751 16:24998376-24998398 GGACAGCGGCACAGGTGGCGGGG + Intronic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1136365277 16:29806642-29806664 GGCCGGGGGCGCGGGCCGCGCGG - Exonic
1136413894 16:30092033-30092055 GGGCTGCGAGGCCGGCGGCGCGG + Intergenic
1136620938 16:31427985-31428007 GGACGGGCGCGCGGGCGGCACGG - Intronic
1136707669 16:32202523-32202545 GGACGGGGGCGGGGGCGGAGCGG + Intergenic
1136760241 16:32726887-32726909 GGACGGGGGCGGGGGCGGAGCGG - Intergenic
1136807863 16:33143499-33143521 GGACGGGGGCGGGGGCGGAGCGG + Intergenic
1138567553 16:57844651-57844673 GGCCTGCGGAGGGGGCGGTGGGG - Intronic
1138940899 16:61787932-61787954 GGACTGTGGTGGGGGGGGCGGGG + Intronic
1139482205 16:67236801-67236823 GGCCTGCGGGGCGGGAGGTGGGG + Intronic
1139545652 16:67648409-67648431 GAGCTGCAGCGCGGCCGGCGCGG - Exonic
1139664520 16:68447105-68447127 GGCCTGCGCCGCGGGCTGGGCGG - Intronic
1139954318 16:70685994-70686016 GGCGGGCGGCGCGGGGGGCGCGG + Exonic
1141665292 16:85462677-85462699 GGAGGGCGGCGGGGGCGCCGCGG + Intergenic
1141839802 16:86567276-86567298 GGACTGCGGCCGGGGGAGCGAGG - Exonic
1142049936 16:87951614-87951636 GGGCTGCGGCGCGGGCGGCCCGG - Intronic
1142054569 16:87985023-87985045 GGACGGCAGCGGGGGCGCCGGGG + Intronic
1142271867 16:89094018-89094040 GGACCGCGGCGGGGTCGGCCGGG + Intronic
1142293066 16:89201515-89201537 GCAGTGGGGCGCGGGCTGCGCGG + Exonic
1203062395 16_KI270728v1_random:987209-987231 GGACGGGGGCGGGGGCGGAGCGG - Intergenic
1142586754 17:979128-979150 GGACGGCGGGGTGGGGGGCGGGG + Intronic
1142683349 17:1562685-1562707 CGACCGCGGCGAGGGCGGCGGGG - Exonic
1142848247 17:2692301-2692323 GGCCTGCGGGGCAGCCGGCGGGG - Intronic
1143483401 17:7239470-7239492 GGCCGGCGGCGCGGGGGGAGGGG - Exonic
1143492892 17:7294362-7294384 AGGCGGCGGGGCGGGCGGCGGGG - Exonic
1144656928 17:17042729-17042751 GGCCTGCGGCGGGGCCGGCGAGG + Intronic
1144775650 17:17783341-17783363 GGGCTGCGGAGGCGGCGGCGCGG + Intronic
1144846980 17:18225342-18225364 GGGCTCCAGCGCGGGCGGCTGGG - Intergenic
1144851687 17:18247131-18247153 GGACCGGGGCGCGGGGGGGGGGG - Intronic
1144854076 17:18258496-18258518 GGACTGCGGCCGGGGCGGGGTGG - Intronic
1145031320 17:19507368-19507390 GGATGGCGGCGCGGGGGACGCGG - Intronic
1145059672 17:19724738-19724760 AGCCTCCGGCGCGGGTGGCGCGG + Intergenic
1145214710 17:21042863-21042885 GGGCGGCGGCGAGGGAGGCGAGG + Exonic
1145937984 17:28726281-28726303 GGGCGGGGGCGCGGGCGGCTGGG - Intronic
1146053302 17:29568650-29568672 CGCGGGCGGCGCGGGCGGCGCGG + Exonic
1146370957 17:32265656-32265678 GGGCTGCGGCGGGGCTGGCGAGG - Intergenic
1146371112 17:32266054-32266076 GGGCTGCGGAGCGGGCGCGGAGG + Intergenic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1147110466 17:38257434-38257456 GGACGAGGGCGCGGCCGGCGGGG + Intergenic
1147168602 17:38605707-38605729 GGGCGGGGGCGCGGGGGGCGGGG + Exonic
1147179243 17:38674298-38674320 GGCCTGGGGAGCTGGCGGCGCGG - Exonic
1147285917 17:39402301-39402323 GCACTGGGGCGGGGGAGGCGGGG - Intronic
1147431101 17:40371334-40371356 GGGCTGTGGCGGGGGCAGCGAGG - Intergenic
1147599840 17:41738842-41738864 GGACTGCGGCGGGGGTGAGGAGG - Intergenic
1147627105 17:41907393-41907415 GGACTGGGGGGAGGGCGGTGGGG - Intronic
1148090253 17:45019076-45019098 GGAGGGCGGCGAGGGCGGCGAGG + Intergenic
1148090256 17:45019085-45019107 CGAGGGCGGCGAGGGCGGCGCGG + Intergenic
1148090259 17:45019094-45019116 CGAGGGCGGCGCGGGCGGCCCGG + Intergenic
1148419041 17:47530997-47531019 GGACGAGGGCGCGGCCGGCGGGG - Intronic
1148555834 17:48578059-48578081 GGGCGGTGGCGGGGGCGGCGGGG + Exonic
1148664173 17:49362158-49362180 GGCCGGCGGGGCGGGCAGCGCGG + Intronic
1149626351 17:58083346-58083368 GGACGGCGGCGCGCGCGGCGGGG + Intergenic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150488886 17:65561295-65561317 GGAGGGGGGCGCGGGCGGGGCGG - Intronic
1151703161 17:75753910-75753932 CGACGGCGGCGCGGGCGGGAAGG + Exonic
1151780146 17:76240269-76240291 GGAGGGCGGCGCGGGCACCGGGG - Exonic
1151780184 17:76240364-76240386 GCGCTGCGGCTCTGGCGGCGGGG + Exonic
1151828598 17:76537252-76537274 GGTCGGCGGAGCAGGCGGCGTGG - Intronic
1152728994 17:81960846-81960868 GCACTGCGCCGGGGGCAGCGAGG - Exonic
1152852689 17:82647463-82647485 GGGATGCGGCCGGGGCGGCGCGG - Intronic
1152924134 17:83079820-83079842 GGGGCGCGGCGCGGGCGGCCTGG + Exonic
1156495881 18:37524876-37524898 GGGCTGGGGCGCGGGGGTCGCGG + Intronic
1157529484 18:48409329-48409351 TGACAGCGGCGCGGCCGGCGAGG - Intronic
1158259049 18:55587932-55587954 AGCCCGCGGCGCGGGAGGCGCGG + Intronic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158893503 18:61893971-61893993 GGACCGCGGAGGGGGTGGCGGGG - Intronic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1158959701 18:62579415-62579437 GGACTGCGTCAAGGGCGGCGTGG - Intronic
1160025064 18:75209651-75209673 CGAGCGCGGCCCGGGCGGCGGGG + Intergenic
1160452424 18:78974404-78974426 GGACTGGCGCGGGGGGGGCGGGG + Intergenic
1160454848 18:78992962-78992984 GCTCTGCGGCGCTGGCGCCGGGG - Exonic
1160691046 19:460832-460854 CGGCGGCGGCGCGGGCGGCTGGG - Exonic
1160725548 19:616476-616498 GGCCCGCGGGGCGGTCGGCGAGG - Exonic
1160763551 19:797533-797555 GGGCTGCGGCGCGGGGAGGGCGG - Intronic
1160784439 19:892925-892947 GGCCTGGGGCGCGGGGCGCGGGG - Intronic
1160859005 19:1229827-1229849 GGGCCGCGGCGCGGGCGGGGAGG + Exonic
1160859057 19:1230072-1230094 GGAGCGCGGCGCGGGCAGCGCGG - Exonic
1160860448 19:1235246-1235268 GGGCCGCGGCACGGGCGGCCGGG + Intronic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160967708 19:1753854-1753876 CGCCGGGGGCGCGGGCGGCGCGG + Exonic
1161152639 19:2717752-2717774 GGTGTTCGGGGCGGGCGGCGTGG - Exonic
1162013189 19:7830292-7830314 GGGCTGCGGGGCGAACGGCGCGG + Intronic
1162079031 19:8208222-8208244 AGACAGGGGCGCGGGGGGCGGGG - Intronic
1162374461 19:10296502-10296524 GGGCGGCGGCGCTGGCGGGGCGG + Exonic
1162392104 19:10395906-10395928 GGTGTGCGGGGCGGGCGGGGCGG - Exonic
1162778757 19:12995918-12995940 GGCCGGCGGCGCGGGCGGAGGGG + Intronic
1162802493 19:13118852-13118874 GGAGAGCGGCGCGGCCGGAGGGG + Intronic
1163631451 19:18419784-18419806 GCACGTGGGCGCGGGCGGCGGGG + Intronic
1163729534 19:18941157-18941179 GGAGGGCGGCGCGGAGGGCGCGG - Intronic
1163807055 19:19405831-19405853 GGCCGGCGGCGCGGGCGGGCGGG + Intronic
1163845755 19:19637400-19637422 GGCGGGCGGCGGGGGCGGCGGGG + Exonic
1164648142 19:29873758-29873780 GGAGAGCGGCGCGGGCGCGGGGG - Intergenic
1164722723 19:30444239-30444261 GGCCTGCTGGGCGTGCGGCGGGG - Exonic
1165243025 19:34482167-34482189 GGACTGAGCCGCGGGGAGCGGGG + Exonic
1165461103 19:35944919-35944941 GGGCTCCGGGGCGGGCGGGGCGG - Exonic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165746003 19:38229707-38229729 GGGCTGCGGCGCGAGCGGAGCGG + Intronic
1166106790 19:40601585-40601607 GGACAGCGGCGCTCCCGGCGGGG + Intronic
1166547011 19:43639844-43639866 GGGGGGCGGGGCGGGCGGCGCGG - Intergenic
1166882939 19:45940210-45940232 GGGCGGCGGGGCGGGCGGAGGGG - Exonic
1167112856 19:47472041-47472063 GGAAGGCGGTGCGGGAGGCGGGG + Exonic
1167454420 19:49591155-49591177 GGAAGGGGGGGCGGGCGGCGGGG - Intergenic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167503938 19:49861724-49861746 GGCCTGCGGCGGGGTGGGCGGGG - Intronic
1167557223 19:50203828-50203850 GGACGGCGGCGAGGGAGGTGGGG + Intronic
1168144895 19:54415473-54415495 CGAGCGGGGCGCGGGCGGCGCGG - Intronic
1168258485 19:55179912-55179934 GGAGTGGGGCGCAGGCGGAGGGG - Intronic
1168315194 19:55481990-55482012 GGGCGGCGGGGCGGGAGGCGCGG - Exonic
1168315198 19:55482002-55482024 GGGCGGGGGCGGGGGCGGCGGGG - Exonic
1168454638 19:56496794-56496816 AGACTGCGGGGCGGGGGGCGGGG + Intergenic
1168462055 19:56567557-56567579 GGACTGGGGCGCGGCGGGGGCGG + Exonic
1202711000 1_KI270714v1_random:19301-19323 GGCTTGCGGCGCGGACAGCGCGG + Intergenic
924987738 2:287622-287644 GGACTGCGCCCTGGGCCGCGCGG - Exonic
925725276 2:6865635-6865657 GGGCCGCTGCTCGGGCGGCGCGG - Exonic
925912702 2:8583758-8583780 AGGCGCCGGCGCGGGCGGCGAGG - Intergenic
927492954 2:23532640-23532662 GGACTGAGGCCTGGGCGGTGGGG + Intronic
929856758 2:45643853-45643875 GGAGTGGGGCGCGGGCGGCCTGG + Intergenic
929983188 2:46699489-46699511 GGACGACGGCGCGGGGGCCGGGG - Intronic
931762591 2:65431260-65431282 GGACCGAGGCGTGTGCGGCGGGG - Intronic
932757912 2:74421683-74421705 GGAACGTGCCGCGGGCGGCGCGG - Intronic
933766212 2:85711308-85711330 GGAGTGCGGGGAGGGCGGCGTGG + Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934966752 2:98730796-98730818 GGCCTCGGGGGCGGGCGGCGGGG - Intronic
935746407 2:106193778-106193800 GGACTCCGGAGCGTGCCGCGTGG - Intronic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936433258 2:112482217-112482239 GGTAGCCGGCGCGGGCGGCGGGG + Exonic
937045104 2:118846976-118846998 GCAAGGCGCCGCGGGCGGCGAGG + Exonic
937132609 2:119524479-119524501 GGACTGGCGCGGGGTCGGCGCGG + Exonic
937478241 2:122234150-122234172 GGGCGGGGGGGCGGGCGGCGGGG + Intergenic
938271855 2:129979678-129979700 GGGCTGCGGCGGCGGCGGCTGGG + Exonic
938444146 2:131364122-131364144 GGGCTGCGGCGGCGGCGGCTGGG - Intergenic
938460233 2:131492096-131492118 GGACGGGGGCGGGGGCAGCGGGG + Intronic
945649132 2:212538050-212538072 GGACCGCGGCCCCGGCGGTGCGG + Intronic
946747486 2:222860889-222860911 GGAGCGCGGCGCTGGCGGCCCGG - Intergenic
947119392 2:226799740-226799762 AGACGGCGGCGCGGTCGGAGGGG - Exonic
947745053 2:232503169-232503191 GGAGCGCGGCGGGGGCGGTGAGG - Intergenic
948046850 2:234951931-234951953 GGGCGGGGGCGCGGGGGGCGGGG - Intergenic
948393260 2:237627405-237627427 GGACGGCGGGGCGGGGGACGGGG - Intergenic
948438128 2:237967396-237967418 TGACCGCGGCGGCGGCGGCGGGG + Intronic
948479145 2:238239613-238239635 GGGCTGCGGGGCGGGCGGGCGGG - Intronic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1168756773 20:324180-324202 GCTCCGCGGCGCGGGGGGCGGGG - Intergenic
1168886902 20:1266435-1266457 GGACTGCGGCGGGTGCAGCTGGG - Intronic
1169195520 20:3680386-3680408 GGACTGAGGCCAGGGCTGCGTGG - Intronic
1169278484 20:4248861-4248883 GGGCGGCGGCGGGGGCAGCGCGG - Exonic
1170150381 20:13221379-13221401 GGGCTGCGGGGTCGGCGGCGGGG - Intergenic
1170163956 20:13343575-13343597 GGGCGGGGGCGGGGGCGGCGGGG - Intergenic
1170204698 20:13785310-13785332 GGGCGGCGGGGCGGGCGACGCGG + Intronic
1172118114 20:32583699-32583721 GGCGTGCGGCGCGGGCCCCGCGG - Intronic
1172280954 20:33707793-33707815 GGACTGCAGCGAGGGCTGCAGGG + Exonic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172654388 20:36528158-36528180 GGAGTGCGGGGCGGGGGGAGGGG - Exonic
1172702669 20:36862838-36862860 GGGCTGCTGCGCGGAGGGCGCGG + Exonic
1173251604 20:41366698-41366720 GACCAGCGGCGGGGGCGGCGCGG - Exonic
1173454100 20:43189782-43189804 GGACTGGGGCGGGCGCGGGGTGG + Exonic
1174204330 20:48827995-48828017 GGACTGGGGGCCGGGCGGCTGGG + Intergenic
1174246716 20:49187782-49187804 GGGCTGGGGCGCAGGCGGGGGGG - Intronic
1174287415 20:49482936-49482958 GGACAGCGCCCCGGGCGGCTGGG - Intergenic
1174607014 20:51768405-51768427 GGGCGGCGGCCCAGGCGGCGCGG - Exonic
1174804699 20:53594546-53594568 GGGGTGCGGGGCGGGGGGCGCGG - Intronic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1175859541 20:62143074-62143096 GGGCAGCGGCGCGGGCGGTCAGG - Intronic
1175982181 20:62744144-62744166 GGACTGCGGCTTGGGAGGCTGGG - Intronic
1176169474 20:63690475-63690497 GGGTGGCGGAGCGGGCGGCGTGG + Intronic
1176197452 20:63844044-63844066 GGACGGTGGGGCGGGCGCCGAGG + Intergenic
1176234823 20:64049344-64049366 GGACTGCGCTGCGGGCTGGGCGG + Exonic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176549734 21:8216030-8216052 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176555709 21:8253272-8253294 TGACGGCGGCGCGGGCGCAGGGG - Intergenic
1176557625 21:8260259-8260281 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176568659 21:8399064-8399086 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1177834080 21:26170687-26170709 AGACGGCGGCGGTGGCGGCGCGG - Intronic
1178103975 21:29298761-29298783 GGGCTTCGGCGCCGGGGGCGGGG + Intronic
1178992264 21:37366346-37366368 GGGCTGCGGGGGCGGCGGCGCGG + Intronic
1179243837 21:39613078-39613100 GGGCTGGGGCGCGGGGCGCGGGG + Intronic
1179529597 21:42009804-42009826 GGCCGGCGGCCCGGGCCGCGGGG - Intronic
1179624515 21:42641232-42641254 GGACGGCGGGGGGGGGGGCGGGG - Intergenic
1179675018 21:42975063-42975085 GGAGCCCGGCGCGGGCGGGGCGG + Intronic
1180014966 21:45075493-45075515 GCTCTGCGCCGCGGGCGGCCCGG + Intronic
1180614908 22:17120701-17120723 GGACTTCGGCGGGGGCGCCGCGG - Exonic
1180650004 22:17369668-17369690 GGTCCTCGGCGGGGGCGGCGGGG - Exonic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180950403 22:19718248-19718270 GGACTGAGGCCCCGGGGGCGCGG + Intronic
1181057853 22:20268316-20268338 GGGTTGGGGCGTGGGCGGCGCGG + Exonic
1181164498 22:20976146-20976168 GGACCGGGGAGTGGGCGGCGAGG + Intronic
1181979609 22:26756826-26756848 TGACGGCGGCGGGGGCGGCCGGG + Intergenic
1183444431 22:37843889-37843911 GGTGAGCGGCGCGAGCGGCGCGG - Exonic
1183546040 22:38455314-38455336 GGTGGGGGGCGCGGGCGGCGGGG - Intergenic
1183578237 22:38706087-38706109 GGACTGCAGCGAGGACGGCGAGG + Exonic
1183649337 22:39145284-39145306 GCACTGCGGAGGGCGCGGCGCGG - Intronic
1184276625 22:43412381-43412403 GGACTCCGGCTGGGGCCGCGGGG + Intronic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1184782978 22:46658358-46658380 GGACGGCGGGGCGGGTGGGGTGG - Intronic
1185255173 22:49827689-49827711 GGGCAGCGGCTCGCGCGGCGCGG + Intergenic
1185397547 22:50600650-50600672 GGAGGGCGGCGGGGGAGGCGGGG - Intronic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
950829529 3:15859967-15859989 GGGCCGCGGCTCGGGCGGGGCGG + Intergenic
950912117 3:16605419-16605441 GGACTGAGGCGTGGTCCGCGGGG + Intronic
951139710 3:19146926-19146948 GGATTCCGGAGTGGGCGGCGCGG - Intergenic
952867229 3:37862121-37862143 GGGGCGCGGCGCGGGGGGCGCGG - Intronic
953326241 3:42014139-42014161 GGCCCGAGGCGCAGGCGGCGCGG - Intronic
953761340 3:45689517-45689539 GGCCTGAGGCGCGGCGGGCGGGG + Intronic
954112195 3:48440334-48440356 GGACTGCGGGGACGGCGGGGTGG + Intronic
954382575 3:50227468-50227490 GGGGTGCGGCGCGGGAGCCGAGG - Intronic
954540739 3:51391657-51391679 GGGCTCCGGCGCTGGCGGCGGGG + Exonic
954615642 3:51967606-51967628 GCACCGCGGCGCGCGGGGCGGGG - Intronic
955298523 3:57756232-57756254 GGACTACGGCGCGGGAGAGGGGG + Exonic
956979060 3:74614889-74614911 GGGCGGCGGCGCGGGCTGGGCGG + Intergenic
958804699 3:98795651-98795673 GGACTGCGGCGGGGGGAGCGAGG + Exonic
961013016 3:123448477-123448499 AGACTGCGGCGCCGGCGCCCCGG - Exonic
961446293 3:126983224-126983246 CGGCGGCGGCGCGGGCGGCTGGG + Intergenic
962259930 3:133895764-133895786 GGAGAGAGGCGCGGGCGGAGCGG + Exonic
962575514 3:136752127-136752149 GGAATGCGGCGGCAGCGGCGCGG - Intronic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
963091445 3:141487057-141487079 GGGCTGCGGCACGGGCCGGGCGG + Exonic
963827487 3:149970870-149970892 GCACTGCAGCGCGGACGGCGAGG + Exonic
964819710 3:160756055-160756077 GGGAGGCGGCGCGGGCGGCAGGG + Intronic
965596748 3:170418686-170418708 GGACTGCGCTGCGGACGGGGTGG + Intergenic
965780359 3:172279216-172279238 GGAGTGGGGGGCGGGGGGCGGGG + Intronic
968405533 4:336847-336869 GGCCTGGGGTGGGGGCGGCGGGG + Intergenic
968434110 4:576196-576218 GGGCTCCGGCGGCGGCGGCGCGG - Intergenic
968573572 4:1354778-1354800 TGAGTGTGTCGCGGGCGGCGTGG - Exonic
968674386 4:1870138-1870160 GGACAGCAGCGGAGGCGGCGCGG + Intergenic
968775177 4:2536147-2536169 GGACAGGGGCGCGGGCGAGGCGG + Intronic
968965566 4:3767539-3767561 GGAGGGGGGCGCGGGCGGTGCGG + Exonic
969113369 4:4857072-4857094 GGACTCCGCCGCGGGGGGGGGGG - Intergenic
969330801 4:6472541-6472563 TGGCTGCGGCGACGGCGGCGAGG + Intronic
970007973 4:11428675-11428697 TGAGTGCGGCGCGCGCGGGGTGG - Intronic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970574567 4:17414463-17414485 CGAGTGCGGCGCGGGCGGGCAGG + Intergenic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
972765862 4:42151958-42151980 GAAGGGCGGCGGGGGCGGCGGGG + Exonic
975870773 4:78776360-78776382 GAGCCGCGGAGCGGGCGGCGGGG + Exonic
977536601 4:98261503-98261525 GGTCTGTGGTGCGGGCGGCGCGG - Exonic
977573985 4:98658334-98658356 GGGCCGCGGCGCTGGCGGCCTGG + Exonic
979122924 4:116926276-116926298 GGGCGGCGGCGCGGGTGGCCTGG - Intergenic
983649799 4:170026524-170026546 GGGCAGCGGGGCGGGCGGTGCGG + Intronic
984928259 4:184825658-184825680 TGTCTGAGTCGCGGGCGGCGCGG - Intronic
985714246 5:1446543-1446565 GGAGTGCGGGGCGGGCGCAGGGG - Intergenic
985813861 5:2111821-2111843 GAAATGCGGGGAGGGCGGCGCGG - Intergenic
986813632 5:11385050-11385072 GCGCGGCGGCGCGGGCAGCGTGG + Exonic
990381922 5:55227325-55227347 GGACCGCCGCGCGGGAGGGGTGG + Intergenic
990696961 5:58429182-58429204 GGACTGGAGCGCGGGAGGGGAGG - Intergenic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992663610 5:78984903-78984925 CGGGGGCGGCGCGGGCGGCGGGG + Intronic
992910791 5:81394163-81394185 GGAGGGCGGGGCGGGCGGAGCGG - Intronic
993654353 5:90558998-90559020 GGTGGGCGGCGAGGGCGGCGCGG + Intronic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
997470578 5:134114918-134114940 GGACTCCGGCGGGGGCGGCGCGG + Exonic
997584061 5:135034355-135034377 GCGCGGCGGCGCGGGCGGCTTGG - Intronic
998130538 5:139649217-139649239 GGACGGCGGCTTGGGCGCCGTGG + Intronic
999129425 5:149271737-149271759 GGGCTGCGGCCCAGGGGGCGAGG + Intergenic
1001506425 5:172283873-172283895 GGCCTGCCGGGCGGGCGGCCCGG - Exonic
1002029365 5:176416535-176416557 TCACTGCGGTGCGGGCGCCGCGG + Exonic
1002710552 5:181192264-181192286 GGAGTGTGGCGGGGGAGGCGGGG + Intergenic
1002927129 6:1611146-1611168 GGACAGGGGCTGGGGCGGCGAGG - Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1004044533 6:12011980-12012002 GGAACGCGGGCCGGGCGGCGCGG - Intronic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1005040336 6:21595143-21595165 GGCGGGCGGCGCGGGCGGTGGGG + Exonic
1005987562 6:30884213-30884235 AGGCAGCGGCGCGGGCGGCTGGG + Intronic
1006351087 6:33521683-33521705 TGAGCGCGGCGCGGGCGGCCCGG + Intergenic
1007444529 6:41895048-41895070 GGACCGCGGCGCCGGCGGGCTGG - Intronic
1007739501 6:44002259-44002281 GGGCGTGGGCGCGGGCGGCGGGG - Intronic
1010209904 6:73354375-73354397 GGACCGCAGCCAGGGCGGCGGGG - Intergenic
1011193706 6:84762627-84762649 GGCCTGCGGCGAGGGCAGAGGGG + Exonic
1012137464 6:95577394-95577416 GGACTAGGGCGGGAGCGGCGCGG - Intergenic
1013230511 6:108157785-108157807 CGGCTGCGGCGGGGGCGGCCGGG - Intronic
1013230572 6:108158030-108158052 GGACTGCAGGGCCGGGGGCGCGG - Intronic
1013283570 6:108661230-108661252 GGACTCTGTCTCGGGCGGCGGGG + Intronic
1014116826 6:117675793-117675815 GGACCGCGGCAGAGGCGGCGCGG - Exonic
1015843048 6:137493490-137493512 CAGCTGCAGCGCGGGCGGCGTGG + Exonic
1019111906 6:169723945-169723967 CGACGGCGGCGGCGGCGGCGCGG - Exonic
1019379152 7:712299-712321 GGAGTGGGGCGCGCGGGGCGGGG - Intronic
1019474298 7:1236622-1236644 GGCAGGCGGCGCGGGCGGCACGG - Exonic
1019474375 7:1236838-1236860 GGGCGACGGCGCGGGCGGCGGGG - Exonic
1019537834 7:1538250-1538272 GGACGGCGGGGGCGGCGGCGGGG + Intronic
1019765063 7:2844065-2844087 GGGCAGCGGCGCGCGCGACGCGG - Exonic
1020274293 7:6615498-6615520 CGACGGCGGCGGCGGCGGCGGGG + Intergenic
1020395807 7:7716653-7716675 GGAGGCCGGCGCGGCCGGCGCGG + Intronic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1022715147 7:32891883-32891905 GGGCGGGGGCGGGGGCGGCGGGG - Exonic
1022923235 7:35037123-35037145 GGCCTGCGGCGCGCGGGGCGCGG - Intronic
1026797867 7:73377554-73377576 GGGCGGCCGGGCGGGCGGCGGGG - Intergenic
1027233031 7:76282893-76282915 GGCCGACGGGGCGGGCGGCGGGG + Intronic
1027250046 7:76393342-76393364 GCACTGCGGCGTGGGAGGGGCGG - Intronic
1029360096 7:100082014-100082036 GGCCTTGGGGGCGGGCGGCGGGG + Intronic
1029456821 7:100675871-100675893 GAACTGGGGCGGGGGGGGCGGGG - Intronic
1029640449 7:101816500-101816522 GGAGCGGGGAGCGGGCGGCGGGG + Intronic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1031531909 7:122886351-122886373 GGACCGCGGGCCGAGCGGCGGGG - Exonic
1032344328 7:131105844-131105866 GGGCCGGGGCGCGGGAGGCGAGG - Intergenic
1033207398 7:139434762-139434784 GCGGTGCGGCGCGGGCGGCCAGG + Intergenic
1034414723 7:150958410-150958432 GTCGGGCGGCGCGGGCGGCGCGG - Exonic
1034441131 7:151086613-151086635 GGACTACTGGGCTGGCGGCGCGG - Intronic
1034470400 7:151251722-151251744 GGACTGCGGCGCCGGGCGCCGGG - Intronic
1034977926 7:155458710-155458732 AGGCGGCGGCGCGGGCGGCTCGG + Exonic
1035004512 7:155644950-155644972 GGACCGCGCCGCGGTGGGCGGGG + Intronic
1035023144 7:155810321-155810343 GCACTGCGGAGAGAGCGGCGGGG - Intronic
1035717178 8:1763604-1763626 GGGGCGCGGCGCGGGGGGCGGGG - Intronic
1036045911 8:5140354-5140376 GGACTGGGGCTCTGGCGGCCCGG - Intergenic
1037825295 8:22156802-22156824 GGACTGCGGCGCGGGCGGCGGGG + Exonic
1037903830 8:22703773-22703795 CGCCCGCGGCCCGGGCGGCGGGG - Intergenic
1038176351 8:25184740-25184762 GGGCACGGGCGCGGGCGGCGCGG + Intronic
1038883612 8:31640103-31640125 GGACCGCGGCCCTGGCGCCGGGG + Intronic
1042307190 8:67343889-67343911 GGAGGGCGGCGCGGGAGGAGCGG + Intergenic
1044248943 8:89984316-89984338 GGAATTCAGCGCGGGCGGTGGGG - Intronic
1044250651 8:90001350-90001372 GGACTGGGACCCAGGCGGCGTGG - Intronic
1047292284 8:123541106-123541128 GGCCCGCGACGGGGGCGGCGGGG + Exonic
1048199801 8:132362873-132362895 GTAATGGGGCGAGGGCGGCGTGG + Intronic
1050512904 9:6413408-6413430 GGAAAGCGGCGCGGGCCGGGCGG + Exonic
1051665645 9:19464977-19464999 GGGCTGCGGCGGGGGCGGCCAGG + Intergenic
1051774517 9:20620550-20620572 CGAGCGCGGCGCGGGGGGCGGGG + Intronic
1052974522 9:34401192-34401214 GGACTGGGGCGCAGACGGCCTGG - Intronic
1053239949 9:36487421-36487443 GGTGGGGGGCGCGGGCGGCGCGG + Intronic
1053434851 9:38068060-38068082 GGAGAGCGCCGCGGGCGGTGGGG - Exonic
1057432227 9:95004935-95004957 GGGCGGCGGCGCGGGCGGGCGGG - Intronic
1057488719 9:95506371-95506393 GGCCGGGGGCGCGGGCGCCGCGG + Intronic
1057596443 9:96418869-96418891 CGAGGGCGGGGCGGGCGGCGGGG - Intergenic
1058053274 9:100427210-100427232 TGGCCGCGGCGCGCGCGGCGGGG + Intronic
1060544695 9:124453071-124453093 GGACGGCTGACCGGGCGGCGCGG + Exonic
1060816463 9:126637988-126638010 GGGCTGCGGAGCGGGAGGAGTGG - Intronic
1060842559 9:126805211-126805233 GGCCAGCGGCGCGAGCGTCGGGG - Intronic
1060916929 9:127397400-127397422 GGGCAGCGGCGAAGGCGGCGAGG - Exonic
1061299661 9:129697386-129697408 CGGCGGCGGCGCGGGCAGCGCGG + Intronic
1061714112 9:132508202-132508224 AGTCGGCGGCGCGGGGGGCGGGG - Intronic
1061802767 9:133121200-133121222 GGGCGGCGGCGCGGCCCGCGCGG + Intronic
1061929211 9:133823876-133823898 GGAATGCGGAGCGGGCAGGGTGG + Intronic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062230680 9:135479989-135480011 GGTCCGCGCGGCGGGCGGCGGGG + Exonic
1062341416 9:136095313-136095335 GCACCGCGGCGGGGGCGGGGCGG + Intergenic
1062346816 9:136118790-136118812 GAAGTGCGGCTCGGTCGGCGCGG - Exonic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062574607 9:137200367-137200389 GGCCCCCGGGGCGGGCGGCGCGG + Exonic
1062659100 9:137619089-137619111 GGGCAGCGGCGGAGGCGGCGCGG + Intronic
1187332651 X:18354726-18354748 GGCCGGCCGCGCGGGGGGCGGGG - Exonic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1189324664 X:40105333-40105355 TGACTGCGGCGGCGGCGGCGGGG - Intronic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1198321358 X:135521414-135521436 GCCCGGCGGGGCGGGCGGCGAGG + Intronic
1198767157 X:140091567-140091589 GGGCGGGCGCGCGGGCGGCGGGG - Intergenic
1200146340 X:153928179-153928201 GGAGGGCGCCGCGGGCGCCGTGG + Intronic
1200292665 X:154887048-154887070 GGGCTGGGGTGCCGGCGGCGGGG - Exonic
1200339509 X:155382788-155382810 GGGCTGGGGTGCCGGCGGCGGGG - Exonic
1200346961 X:155457905-155457927 GGGCTGGGGTGCCGGCGGCGGGG + Exonic