ID: 1037826753

View in Genome Browser
Species Human (GRCh38)
Location 8:22164666-22164688
Sequence TCCAGCGGCGTCTCCGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037826746_1037826753 0 Left 1037826746 8:22164643-22164665 CCATCCACGGGCTTTCGGCGCCC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1037826753 8:22164666-22164688 TCCAGCGGCGTCTCCGGAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 85
1037826740_1037826753 30 Left 1037826740 8:22164613-22164635 CCTCGGCGGGGGAGAGGGGCTCG 0: 1
1: 0
2: 4
3: 17
4: 233
Right 1037826753 8:22164666-22164688 TCCAGCGGCGTCTCCGGAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 85
1037826747_1037826753 -4 Left 1037826747 8:22164647-22164669 CCACGGGCTTTCGGCGCCCTCCA 0: 1
1: 0
2: 0
3: 13
4: 96
Right 1037826753 8:22164666-22164688 TCCAGCGGCGTCTCCGGAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037826753 Original CRISPR TCCAGCGGCGTCTCCGGAGG AGG Intergenic
901400814 1:9014157-9014179 TCCAGTGGCGTGTCGGGAAGAGG - Intronic
901448299 1:9321195-9321217 TGCAGAGGCGTCTCAGGCGGTGG + Intronic
901652725 1:10752341-10752363 TCTAGGGGCCTCTCCAGAGGAGG - Intronic
1065844916 10:29736213-29736235 TCCAGCCGCGTCCTCGGAGGTGG + Intronic
1067812591 10:49441618-49441640 GCCGCCGGCGTCTCCGCAGGTGG + Intergenic
1070580645 10:77716495-77716517 TCCATCGGTGTCTCCTGAGTGGG - Intergenic
1070835728 10:79445758-79445780 TCCAGCGGCGGCTCCGGGGGTGG + Intergenic
1075645193 10:124092418-124092440 CCCCGCCGCGTCTCGGGAGGCGG - Intronic
1076566581 10:131403370-131403392 TCCAGAGGCCACTCCGAAGGGGG - Intergenic
1084893825 11:72250917-72250939 TCCAGCTGCCTTTCCGAAGGGGG + Intergenic
1091108441 11:132943811-132943833 TCGTGCCGCGTCCCCGGAGGAGG - Intronic
1111822195 13:93227774-93227796 TCCTGCGGCTTCTTCGGCGGGGG + Intronic
1115754480 14:36518554-36518576 TCCAGCGGAGTCTGGGCAGGTGG - Intronic
1116012735 14:39369683-39369705 TTCAGTGGGGTCTCAGGAGGTGG + Intronic
1116928711 14:50668410-50668432 TCCAGGCGCGGCTCCGGCGGCGG + Intergenic
1121117207 14:91352146-91352168 GCCACCGCCGTCTGCGGAGGAGG - Intronic
1123171580 14:106377749-106377771 TCTAGGGGCTTCTCCAGAGGAGG + Intergenic
1202896085 14_GL000194v1_random:11251-11273 TCCAGCGCTGTCCCTGGAGGGGG + Intergenic
1123783423 15:23647084-23647106 GCCATCGGTGTCCCCGGAGGTGG + Exonic
1123783434 15:23647114-23647136 GCCATCGGTGTCCCCGGAGGGGG + Exonic
1123783445 15:23647144-23647166 GCCATCGGTGTCCCCGGAGGGGG + Exonic
1123783456 15:23647174-23647196 GCCATCGGGGTCCCCGGAGGAGG + Exonic
1123783467 15:23647204-23647226 ACCATCGGGGTCCCCGGAGGAGG + Exonic
1123783480 15:23647234-23647256 GCCATCGGGGTCCCCGGAGGAGG + Exonic
1125200737 15:37099012-37099034 CCCAGCGGCGGCCCCGGCGGCGG + Intronic
1125714138 15:41809754-41809776 TCCAGAGGCAGCTCCGGAGATGG - Intronic
1126626035 15:50686605-50686627 TCGGGAAGCGTCTCCGGAGGCGG + Exonic
1132115207 15:99131039-99131061 CCCAGCGCCCTCTCTGGAGGGGG + Exonic
1132345664 15:101107260-101107282 TCCCGCAGCGCCTCTGGAGGGGG - Intergenic
1135024670 16:18989794-18989816 TCCAGAGGCCTCTCGGGGGGAGG + Intronic
1142009451 16:87706424-87706446 TCCAGGGGGGTCGGCGGAGGGGG + Intronic
1142442282 16:90106567-90106589 GCCAGCGGCGTCTCCCGAGTAGG - Intergenic
1144498451 17:15765179-15765201 TCCAGCGCTCTCTCTGGAGGGGG - Intergenic
1145161833 17:20580220-20580242 TCCAGCGCTCTCTCTGGAGGGGG - Exonic
1147486375 17:40818937-40818959 TCCAGCGGCGGCTACGGTGGTGG - Exonic
1147486387 17:40818988-40819010 TCCGGCGGCGGCTACGGGGGCGG - Exonic
1147486400 17:40819030-40819052 TCCGGCGGCGGCTACGGAGGCGG - Exonic
1148324198 17:46773722-46773744 TCCAGCGGCGGCCCCGGAACTGG + Exonic
1148855377 17:50576191-50576213 TCCTTCAGCGTCTCCGGTGGAGG - Exonic
1149430615 17:56593724-56593746 TCCAGCGGCGGCGGCGGCGGCGG - Exonic
1150777800 17:68095699-68095721 TCCAGCGGCAGCTCCGCAAGAGG + Intergenic
1160806579 19:994779-994801 TCCAGCGCCTTCTCGGGAGGGGG - Intronic
1160820138 19:1054074-1054096 TCCAGCGCTGTCTCCTGTGGCGG - Exonic
1161494899 19:4581433-4581455 CCCCGGGGCGTCTGCGGAGGGGG - Intergenic
1167019098 19:46861101-46861123 TCCAGCGGCGGCTGAGGCGGCGG - Intergenic
1167331978 19:48861656-48861678 ACCAGCGGCGTTTCCAGAGACGG + Exonic
1167471143 19:49677168-49677190 TCCAGCGGGGTCGCGGTAGGCGG + Intronic
1168251973 19:55146690-55146712 TCCAGAGGAGGCTGCGGAGGAGG - Exonic
930136240 2:47906120-47906142 GCGAGCGGCGTCTCCGGCAGCGG + Intergenic
930730416 2:54723612-54723634 TCCAGCCGGGGCTCCGGGGGCGG - Intronic
933597858 2:84300827-84300849 TCCAACAGCGTCTGCAGAGGTGG + Intergenic
936068475 2:109349678-109349700 TCCAGGGGCCTCACAGGAGGAGG + Intronic
947429197 2:230010823-230010845 TCCAGCGGCAGCTCCGCAAGAGG + Exonic
948206856 2:236167244-236167266 ACAAGCGGGGTCTCGGGAGGGGG - Intronic
948496917 2:238356589-238356611 TCCAGCCCCGTCTTGGGAGGGGG + Intronic
948770744 2:240250259-240250281 CCCAGCAGTGTCTCAGGAGGTGG - Intergenic
948833518 2:240612724-240612746 GCCAGCGGGGCCTCGGGAGGAGG + Intronic
1176615762 21:9027235-9027257 TCCAGCGCTGTCCCTGGAGGGGG + Intergenic
1181160571 22:20957497-20957519 TCCAGCGCCGACTCCGGGGAAGG + Intergenic
1185259529 22:49853850-49853872 TCCGGCGGCGTCGCGGGCGGCGG + Exonic
954035996 3:47851509-47851531 TCCAAGGGCTTCTCTGGAGGGGG - Intronic
954458266 3:50611659-50611681 GGCAGCGGCGACTCCGGAGTGGG + Exonic
954917922 3:54164445-54164467 TCCAGGGGAGTCCCCCGAGGAGG - Intronic
961455939 3:127023930-127023952 TCCTGGGTCGTCTCTGGAGGTGG + Intronic
968362553 3:198157531-198157553 GCCAGCGGCGTCTCCCGAGTGGG - Intergenic
968540860 4:1167638-1167660 TCCAGCGGCGTTTCTGGAACTGG + Exonic
969724427 4:8910940-8910962 TCCACTGGAGCCTCCGGAGGGGG + Intergenic
972356844 4:38287289-38287311 TTCAGCGGCATCTCAGGAGGGGG + Intergenic
976495641 4:85726466-85726488 TCCAGTGGGGTCCCCTGAGGCGG + Intronic
986216290 5:5722255-5722277 TCCATTGGCCTCTGCGGAGGTGG + Intergenic
988727440 5:33938554-33938576 TCCAGCGACTTCTGCGGAGAGGG + Intergenic
1002556508 5:180046025-180046047 TCCAGTGGCGTGGACGGAGGGGG + Intronic
1003505126 6:6734373-6734395 TCCAGCGGTGTGTCTGGAGGGGG - Intergenic
1004395895 6:15246049-15246071 TCCAGCGGCGGCGGCGGCGGCGG - Intergenic
1006072701 6:31508618-31508640 ACCTGCGGCGTCTCCCGTGGAGG + Intronic
1013232145 6:108168644-108168666 TGCAGCGGCGCCACCGGCGGGGG - Intronic
1017671914 6:156777540-156777562 TCCGGCGGGGCCTGCGGAGGGGG + Intergenic
1017778318 6:157696832-157696854 TCCATCAGCCTCTCAGGAGGTGG - Intergenic
1019253129 7:31176-31198 GCCAGCGGCGTCTCCCGAGTGGG + Intergenic
1020096245 7:5371055-5371077 GGCAGCGGCGACTCCAGAGGCGG + Exonic
1027232656 7:76281714-76281736 TCCAGCAGCGACTCCGGCAGCGG + Exonic
1032240332 7:130154551-130154573 TCCTGCGGGGCCTCCCGAGGAGG - Intergenic
1034266174 7:149782117-149782139 TCCAGAAGCCTCTCCGGAGAGGG + Intergenic
1036398230 8:8386489-8386511 GCGGGCGGCGTCACCGGAGGCGG - Exonic
1037826753 8:22164666-22164688 TCCAGCGGCGTCTCCGGAGGAGG + Intergenic
1043052104 8:75396972-75396994 TCCAGCTGGGTTTCCGGTGGTGG + Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1051591178 9:18777672-18777694 TCCCCCGGCGTCCCCGGTGGAGG - Exonic
1052603644 9:30671473-30671495 TCCAGCGCTGTCCCTGGAGGGGG + Intergenic
1056532425 9:87498618-87498640 TTCCGCGGCGTCCCTGGAGGTGG + Intronic
1059434854 9:114269973-114269995 TCCAGGGGCGTCTCTAGAGCTGG + Intronic
1062747241 9:138221190-138221212 GCCAGCGGCGTCTCCCGAGTGGG - Intergenic
1186826927 X:13349690-13349712 TCCATCTGCGTCTCCTGAAGCGG - Intergenic
1189320381 X:40083799-40083821 TCCAGCAGCCTCCCCGGAGGCGG + Intronic
1189325798 X:40109842-40109864 TCCTGCGGCGTCGCAGAAGGAGG + Intronic
1189763171 X:44343453-44343475 TCCAGGAGAGTCTGCGGAGGTGG + Intronic
1193492347 X:82165415-82165437 TCCAACGACTTCTGCGGAGGGGG + Intergenic
1201149159 Y:11085958-11085980 TCCAGCGCTGTCCCTGGAGGGGG + Intergenic