ID: 1037828902

View in Genome Browser
Species Human (GRCh38)
Location 8:22176919-22176941
Sequence CAGGGGGGCGGTCCCGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828902_1037828925 29 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828902_1037828924 28 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1037828902_1037828921 26 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828902_1037828911 -3 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828911 8:22176939-22176961 CTGAGCTGGCCCCGCCCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 399
1037828902_1037828917 13 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828917 8:22176955-22176977 CTCCAGGTGCTGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 20
4: 151
1037828902_1037828923 27 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828902_1037828918 14 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828918 8:22176956-22176978 TCCAGGTGCTGCTCCTACGTGGG 0: 1
1: 0
2: 1
3: 12
4: 102
1037828902_1037828920 23 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828920 8:22176965-22176987 TGCTCCTACGTGGGTCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828902 Original CRISPR CAGGGGGGCGGTCCCGAGCT GGG (reversed) Intronic
900189776 1:1348514-1348536 CAGGGTGGGGTTCCCTAGCTGGG - Intronic
900421728 1:2558685-2558707 CAGGTGGGCCATCCTGAGCTTGG + Intronic
900671293 1:3856789-3856811 CGGGGGCGCGGTCCCCACCTGGG - Intronic
901733198 1:11295308-11295330 CAGGGGGGCTTTCTCCAGCTGGG - Intronic
903164288 1:21509785-21509807 CTGCAGGGCGGTCCCGAGCGCGG - Intronic
914993157 1:152515727-152515749 CAGCGGGGCGGGCCCGCTCTGGG - Exonic
916078204 1:161215408-161215430 CAGGGTGGAAGTCCAGAGCTTGG + Intronic
1072799882 10:98385510-98385532 CAGGGGGGCAGAACCGTGCTCGG - Intronic
1072810304 10:98456350-98456372 CAGGCGGGCGGTCCCTAGGCAGG - Intergenic
1074682030 10:115916918-115916940 CAGGGGGCCAGTCCTGAGCCTGG - Intronic
1081714031 11:45235916-45235938 CATGGGGGCGGGCCTGAGCCTGG - Intergenic
1084169937 11:67396235-67396257 CAGGGGAGGGGGCCCAAGCTAGG - Intronic
1084736561 11:71109140-71109162 CAGGTGGGCTGTCCTGGGCTGGG - Intronic
1090474057 11:127003845-127003867 CAGCGGGGCGAGCCGGAGCTGGG + Intergenic
1091770985 12:3151306-3151328 CAGGGGAGCCCTCCCGAGCCTGG - Intronic
1095937952 12:47705633-47705655 CAAGGGGGCGGGCCCCACCTCGG + Intronic
1096840973 12:54379100-54379122 CGGGGTGGCGGACCCGGGCTGGG + Intronic
1100611295 12:96194092-96194114 CGGGAGGGGGGTCCCGAGGTGGG - Intergenic
1100685882 12:96985692-96985714 CAGGTGAGCGGACCCGCGCTGGG + Intergenic
1104943334 12:132404918-132404940 CGGGGGGGGCGTCCAGAGCTGGG + Intergenic
1112290695 13:98142713-98142735 CAGGCGGGCGGTCAGGGGCTCGG - Exonic
1123014482 14:105367289-105367311 CAGGGAGGCGATCCAGATCTCGG - Exonic
1123035782 14:105471386-105471408 CAGGGGGGTGGTCTGGAGCCAGG - Intergenic
1123061126 14:105594969-105594991 CAGGGGCGCTGTTCCGAGCCTGG + Intergenic
1123085581 14:105715880-105715902 CAGGGGCGCTGTTCCGAGCCTGG + Intergenic
1126746433 15:51830109-51830131 GAGGGGGCCGGTCCCGAACCCGG - Intronic
1128161049 15:65422988-65423010 CGGGGGCCCGGGCCCGAGCTGGG + Exonic
1128269301 15:66294085-66294107 AAATGGGGAGGTCCCGAGCTGGG + Intronic
1132681966 16:1146110-1146132 CAGAGGGGCTGTGCAGAGCTGGG + Intergenic
1136552790 16:30990377-30990399 CAGGTGGGCTGTCCTGAGCTGGG - Exonic
1144269025 17:13600506-13600528 GAGCGGGGCGGGCCCGGGCTGGG - Intronic
1144515876 17:15917466-15917488 CAGGGGCGCGGTCCCAGGATGGG - Intergenic
1144793100 17:17872756-17872778 GAGGGGGTGGGTCCTGAGCTGGG - Intronic
1147962633 17:44177346-44177368 CCAGGGGGCTGTCCCCAGCTTGG + Intronic
1149296235 17:55264891-55264913 CAGGCGGGCGGTGCCGCGCGTGG + Intergenic
1151469665 17:74310081-74310103 CAGGGTGGTTGTCCCCAGCTGGG - Exonic
1153794435 18:8609609-8609631 CGGGGGGTCGGCCCCGGGCTCGG - Exonic
1161681338 19:5681217-5681239 CGGGGGTGGGGTCCCGGGCTGGG - Exonic
1161851584 19:6740331-6740353 CCAGGGGGCGGTCCCGCCCTGGG - Intronic
1164419473 19:28075954-28075976 CAGGGGAGGGGTCTAGAGCTTGG + Intergenic
1165445970 19:35856857-35856879 CCGGGGGGCGGACCCGGGCGGGG + Intronic
1167473105 19:49686264-49686286 CTGGGGGCCGTTCCCGAGCCAGG + Intronic
928569927 2:32596249-32596271 GAGGTGGGCGGTCACGAGGTCGG + Intronic
940775182 2:157876651-157876673 CGGCGGGGCAGGCCCGAGCTGGG + Intergenic
948805684 2:240452727-240452749 GACGGGGGCGGTGCCGAGCGCGG + Intronic
1172697299 20:36831541-36831563 CAAGGGGTCCGTGCCGAGCTGGG - Intronic
1176045135 20:63088590-63088612 CTGGGAGAGGGTCCCGAGCTGGG + Intergenic
1176298841 21:5088919-5088941 CAGTGGGGCGTTCTCCAGCTGGG - Intergenic
1179858185 21:44173030-44173052 CAGTGGGGCGTTCTCCAGCTGGG + Intergenic
1182508595 22:30802997-30803019 GAGGAGGGCGGTCCCGGGATTGG - Intronic
1183401692 22:37608825-37608847 CGGGGGGGCGGTGCCGAGGCTGG + Exonic
1183490963 22:38115440-38115462 CTGGGGGTCGGTCCCTAGCATGG + Intronic
1184733703 22:46385570-46385592 CAGGGGACAGGTCCCGGGCTAGG - Intronic
950422479 3:12907082-12907104 CTGGGGGACCGTCCCGGGCTTGG - Intronic
953981009 3:47412976-47412998 GAGGAGGGGGGCCCCGAGCTGGG - Exonic
954150936 3:48656670-48656692 CAGGGCGCCGGGCCAGAGCTGGG - Intronic
967685357 3:192410161-192410183 CAGGGGCCCGGCCCCCAGCTCGG - Intronic
969855235 4:9993910-9993932 CAGTGGGGCTGTTCCTAGCTAGG - Intronic
976249481 4:83035413-83035435 CAAGGGGGCGGGCCTGAGGTCGG + Intronic
977716635 4:100190511-100190533 CAGGTGGGCGGGCCTGAGCAGGG - Intronic
984735093 4:183100106-183100128 CTGGCCGGAGGTCCCGAGCTGGG + Intronic
988636640 5:32991555-32991577 CAGCCGGGCGTTGCCGAGCTTGG - Intergenic
997465318 5:134084242-134084264 CAGAGGGGAGGTGCCGAGGTAGG + Intergenic
999126925 5:149252725-149252747 AAGGGGGGTGGTCTCCAGCTTGG - Intronic
1002580610 5:180207831-180207853 CAGGGAGGCTGTCCTGAGCGGGG - Intronic
1005965164 6:30721664-30721686 CGGTGGGGCGGTGCCCAGCTTGG + Intronic
1016262393 6:142187933-142187955 CCGGGAGGAGGTCCGGAGCTGGG + Intronic
1016843205 6:148544627-148544649 CAGGGGGGCGGCCTTGTGCTTGG - Exonic
1019517243 7:1445453-1445475 GGGGTGGGCGGTGCCGAGCTGGG - Intronic
1022538376 7:31112594-31112616 CAGGGGGGTGTTCCCAAGCTGGG + Intergenic
1023076299 7:36486066-36486088 CAGGGAGGCAGTCCAAAGCTTGG - Intergenic
1024520369 7:50300559-50300581 CAGGGGGCTGGTGCAGAGCTAGG - Intergenic
1026895993 7:74010389-74010411 CTGGGGGGAGGTCTCCAGCTTGG - Intergenic
1029535408 7:101154752-101154774 CGGCGGGGCCGTCCCGAGCCGGG + Intronic
1033333820 7:140435691-140435713 CAGGAGGGCCCTCCTGAGCTAGG + Intergenic
1035193878 7:157198483-157198505 GAGGGCGGCGGCCCTGAGCTCGG - Intronic
1035573368 8:688353-688375 CCGGGGGGCGGGGCCGAGGTGGG - Intronic
1037828902 8:22176919-22176941 CAGGGGGGCGGTCCCGAGCTGGG - Intronic
1046870220 8:119197432-119197454 GAGGAGGGCGGTCCCTGGCTAGG - Intronic
1047402659 8:124559282-124559304 CATGAGGGCGGACCCCAGCTCGG + Intronic
1048338330 8:133519666-133519688 CAGGCGTGCGCTCCCGAGCCCGG - Intronic
1049651894 8:143773663-143773685 CTGGGGGTGGGTCCCTAGCTGGG - Intergenic
1049760759 8:144331081-144331103 CAGGTGGGCAGGCCCCAGCTTGG + Exonic
1053013182 9:34646991-34647013 CGAGAGGGCGCTCCCGAGCTTGG + Intronic
1057696668 9:97327968-97327990 CAGGGGTGTGGTTCCTAGCTGGG + Intronic
1059394571 9:114026281-114026303 GAGGGGAGCGGTCCCAAGCGGGG + Intronic
1060152844 9:121299759-121299781 CTGGGGGGCGGTCCCCGGCTTGG + Intronic
1061133518 9:128721119-128721141 CACGGGGCCTGTCCCCAGCTGGG - Exonic
1062467171 9:136686583-136686605 CAGGGGCGCGCTCCCCAGCACGG + Intronic
1062582063 9:137233160-137233182 CAGGTGGGGGGGCCCGGGCTGGG - Intronic
1062625463 9:137440249-137440271 CTGGGGGGCTGTCCTGATCTGGG - Intronic
1189069322 X:37847344-37847366 CAGGGGAGAGGACCCGGGCTCGG + Intronic
1190317003 X:49157445-49157467 CAGGGTGGCGGGCCCGTGCCTGG + Intergenic
1191249836 X:58255021-58255043 CAGGGGCGAGGTCCAGGGCTAGG - Intergenic
1195485587 X:105401590-105401612 CTGGGAGGCAGTCCAGAGCTAGG + Intronic
1199679071 X:150213139-150213161 CAGGGGGTGGGCCCCAAGCTGGG + Intergenic