ID: 1037828903

View in Genome Browser
Species Human (GRCh38)
Location 8:22176920-22176942
Sequence TCAGGGGGGCGGTCCCGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828903_1037828921 25 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828903_1037828923 26 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828903_1037828918 13 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828918 8:22176956-22176978 TCCAGGTGCTGCTCCTACGTGGG 0: 1
1: 0
2: 1
3: 12
4: 102
1037828903_1037828924 27 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1037828903_1037828911 -4 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828911 8:22176939-22176961 CTGAGCTGGCCCCGCCCTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 399
1037828903_1037828925 28 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828903_1037828920 22 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828920 8:22176965-22176987 TGCTCCTACGTGGGTCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 33
1037828903_1037828917 12 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828917 8:22176955-22176977 CTCCAGGTGCTGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 20
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828903 Original CRISPR TCAGGGGGGCGGTCCCGAGC TGG (reversed) Intronic
903857584 1:26345909-26345931 GCAGGGGGGCTGTGCCCAGCAGG + Exonic
908179416 1:61589220-61589242 TCAAGGGCGCCGTCCCCAGCGGG + Intergenic
912960050 1:114188233-114188255 TGAGGGGGGCGGTTCCAAGATGG - Intergenic
917817555 1:178725675-178725697 TCAGGACGGCGCCCCCGAGCGGG - Intronic
917846598 1:179025749-179025771 TAAGGGGGGCAGTCCGGAGCGGG + Intergenic
1065081259 10:22131453-22131475 TCTGGGGGGCGGTTCCAAGATGG - Intergenic
1066596024 10:37050634-37050656 TCAGGGGAGCGGTTCCAAGATGG - Intergenic
1068602193 10:58967859-58967881 TCAGGTGGGCGTTCCGGTGCGGG + Intergenic
1071207105 10:83294266-83294288 TCAGAGGGGCGGTTCCAAGATGG + Intergenic
1074789430 10:116871838-116871860 TCAGGTGGGTGGTCCCCAGGTGG - Intronic
1076474911 10:130745146-130745168 TCAGGGGCTCTGTCCCCAGCAGG - Intergenic
1076499461 10:130924775-130924797 TCAGGGCGGCTCTCACGAGCGGG + Intergenic
1076727333 10:132419732-132419754 TCAGCGGGGCTGCCCGGAGCTGG + Intergenic
1079284626 11:19117478-19117500 TGAGGGGTGAGGGCCCGAGCCGG + Intronic
1084173256 11:67410557-67410579 CCATGGTGGCGGTCCCGAGGGGG - Intronic
1084412650 11:69013368-69013390 TCTGGGGGGGGCTCCTGAGCGGG - Exonic
1084736562 11:71109141-71109163 TCAGGTGGGCTGTCCTGGGCTGG - Intronic
1088823373 11:113474941-113474963 CCAGGCGGGCGCTCCCGAGCAGG + Intronic
1089216033 11:116835323-116835345 TCAGCGGGGCGGGACGGAGCGGG - Intergenic
1092259968 12:6947755-6947777 TCAGGGAGGCCTTCCCGAGGAGG + Intronic
1095752288 12:45727092-45727114 TCAGGCGAGCGGTGCCGACCGGG + Intergenic
1098692355 12:73504190-73504212 GCAGGGGGGCGGTTCCAAGGTGG - Intergenic
1103193411 12:119021629-119021651 TCAGGGGTGGGGTCCCTAGTGGG - Intronic
1112441115 13:99425913-99425935 TCAGGGGGCAGTTCCCAAGCAGG + Intergenic
1114394832 14:22348918-22348940 TTAGGGGGGCGGTTCCAAGATGG + Intergenic
1119357351 14:74018647-74018669 TCCGGGGGGCGGTCGTGGGCAGG + Intronic
1121473232 14:94173451-94173473 TCAGCGTGGCTGTCCAGAGCAGG + Intronic
1122123009 14:99564596-99564618 CCAGGGGGGCAGGCCCCAGCTGG + Intronic
1124657879 15:31523554-31523576 TCAGGGAGGAGGCCCCAAGCGGG - Intronic
1128161048 15:65422987-65423009 TCGGGGGCCCGGGCCCGAGCTGG + Exonic
1134102319 16:11460985-11461007 TCAGGGAGTTGGTCCAGAGCTGG + Exonic
1136014482 16:27386690-27386712 TCAGGGTGGGGGTCATGAGCAGG - Intergenic
1136500776 16:30668876-30668898 TCAGGGGGCCGGACCCAGGCAGG - Exonic
1136552791 16:30990378-30990400 CCAGGTGGGCTGTCCTGAGCTGG - Exonic
1138448221 16:57077881-57077903 GCAGGGCGGGGGTCCCGAGTGGG + Intronic
1143201461 17:5116271-5116293 TGAGGGGGGCCGCCCGGAGCGGG - Intronic
1143573831 17:7778151-7778173 TCAGGGGGGTGATGACGAGCCGG - Exonic
1143630571 17:8137470-8137492 TCAGGGGGGAGTTCTGGAGCTGG + Intergenic
1144269026 17:13600507-13600529 TGAGCGGGGCGGGCCCGGGCTGG - Intronic
1144930584 17:18855884-18855906 TCAGGGTGGCGGGCCCAGGCGGG + Intronic
1151317775 17:73334701-73334723 GAAGGGGGGTGGTCCCGAGGGGG + Exonic
1152349710 17:79777950-79777972 TCCGGCGGGGGGTCCCGCGCGGG - Intergenic
1160706623 19:532848-532870 TCCGGGACGCGGGCCCGAGCCGG - Intronic
1160995673 19:1881011-1881033 TCAGGGAGGCCATCCCCAGCTGG - Exonic
1162128505 19:8511817-8511839 TCCGGGGGGCGCTCCGGCGCGGG + Exonic
1162927476 19:13937652-13937674 GCAGGAGGGCGGTGCAGAGCAGG - Intronic
1165445968 19:35856856-35856878 CCCGGGGGGCGGACCCGGGCGGG + Intronic
1166294987 19:41884495-41884517 TGAGGGACGCGGTCCCCAGCGGG + Intronic
1166732041 19:45064548-45064570 TCAGGTGGGGGCTCCCGAGACGG + Exonic
1167698125 19:51026653-51026675 GCAGGGGGGCGGCCCTGGGCGGG + Intronic
1168149345 19:54436414-54436436 GCAGGGAGGCGGTCCTGTGCAGG - Exonic
924962502 2:46694-46716 CCAGGGAGGCGGGCCCGGGCGGG - Intronic
935595426 2:104873837-104873859 TCAGGGGAGGGTCCCCGAGCGGG - Intergenic
1180043999 21:45294442-45294464 ACAGGGGAGCGGTCACAAGCCGG - Intergenic
1184250424 22:43257149-43257171 TCAGGGAGCAGGGCCCGAGCGGG - Intronic
1184360884 22:44017881-44017903 TCAGGGGGGCCTTCCAAAGCAGG + Intronic
1185068579 22:48644214-48644236 TCGGGGAGGGGGCCCCGAGCGGG + Intronic
954200860 3:49022307-49022329 TCAGGGGCGCGGGGCCGGGCCGG - Intronic
956207471 3:66769787-66769809 TCGGGGGGGCGGTTCCAAGATGG - Intergenic
963191812 3:142481217-142481239 TCAGAGGGGCGGTTCCAAGATGG - Intronic
968084757 3:195869317-195869339 TCCGGGGGGCGGGCTCGAGGGGG + Intronic
977496105 4:97777924-97777946 TCAGGGGGGTGGTTCCAAGATGG + Intronic
977681048 4:99798746-99798768 ACAGGGGGGCGGTTCCAAGATGG - Intergenic
977716636 4:100190512-100190534 GCAGGTGGGCGGGCCTGAGCAGG - Intronic
985651190 5:1108535-1108557 TCAGGAGGGCGTTCCCGACACGG - Intronic
997969865 5:138392236-138392258 TCAGGGGGGCAGTCCGAGGCCGG - Exonic
1000100270 5:158009490-158009512 TCAGAGGTGAGGTCCTGAGCAGG - Intergenic
1001407019 5:171483650-171483672 TGAGAGGGGCGGCCACGAGCAGG - Intergenic
1002580611 5:180207832-180207854 TCAGGGAGGCTGTCCTGAGCGGG - Intronic
1008598454 6:53065727-53065749 TCCGGGGGGCGGTGCAGAGGGGG + Intronic
1008816890 6:55579136-55579158 GGAGGGGCGCGCTCCCGAGCTGG - Exonic
1017311589 6:152982829-152982851 TGAGGGGAGCGGTCGCGAGGGGG - Intronic
1018978698 6:168584873-168584895 TCTGGGGGGCTGTCCCGGGATGG - Intronic
1020445495 7:8262531-8262553 TCTGGGCGGCGGATCCGAGCGGG - Intronic
1022538375 7:31112593-31112615 TCAGGGGGGTGTTCCCAAGCTGG + Intergenic
1025708925 7:63890472-63890494 TCAGGGGGGCTGACCCTGGCAGG + Intergenic
1029535407 7:101154751-101154773 GCGGCGGGGCCGTCCCGAGCCGG + Intronic
1032125395 7:129189231-129189253 GCCGGGGGGCGGCCTCGAGCGGG + Exonic
1034494062 7:151409809-151409831 CCAGGGCGGAGGTCCCGAGTGGG - Intronic
1037828903 8:22176920-22176942 TCAGGGGGGCGGTCCCGAGCTGG - Intronic
1049214883 8:141402939-141402961 CCAGCGGGCCGGTCCAGAGCAGG + Intronic
1049651895 8:143773664-143773686 TCTGGGGGTGGGTCCCTAGCTGG - Intergenic
1049689864 8:143953697-143953719 TCCTGGGGCCGGGCCCGAGCCGG - Intronic
1053600506 9:39604227-39604249 TCAGGGCGGCGGGCCGCAGCCGG - Intergenic
1053858154 9:42358083-42358105 TCAGGGCGGCGGGCCGCAGCCGG - Intergenic
1054253023 9:62738157-62738179 TCAGGGCGGCGGGCCGCAGCCGG + Intergenic
1054567139 9:66772656-66772678 TCAGGGCGGCGGGCCGCAGCCGG + Intergenic
1055386052 9:75763153-75763175 TCAGGGGGGTGGTTCCAAGATGG - Intergenic
1057696667 9:97327967-97327989 TCAGGGGTGTGGTTCCTAGCTGG + Intronic
1057819178 9:98318201-98318223 TCAGGTGCGCGGTCCCGGGTGGG + Intronic
1059394570 9:114026280-114026302 AGAGGGGAGCGGTCCCAAGCGGG + Intronic
1062582064 9:137233161-137233183 TCAGGTGGGGGGGCCCGGGCTGG - Intronic
1062625464 9:137440250-137440272 TCTGGGGGGCTGTCCTGATCTGG - Intronic
1189534431 X:41922839-41922861 GCAGGGGGCAGGCCCCGAGCGGG + Intronic
1196507325 X:116462879-116462901 TGAGGGGGTCCGTCCCGAGAAGG - Exonic