ID: 1037828906

View in Genome Browser
Species Human (GRCh38)
Location 8:22176934-22176956
Sequence AGGGCGGGGCCAGCTCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 444}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828906_1037828918 -1 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828918 8:22176956-22176978 TCCAGGTGCTGCTCCTACGTGGG 0: 1
1: 0
2: 1
3: 12
4: 102
1037828906_1037828926 22 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828926 8:22176979-22177001 TCGCCGCGGCGGGGGCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218
1037828906_1037828921 11 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828906_1037828925 14 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828906_1037828924 13 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1037828906_1037828917 -2 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828917 8:22176955-22176977 CTCCAGGTGCTGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 20
4: 151
1037828906_1037828923 12 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828906_1037828920 8 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828920 8:22176965-22176987 TGCTCCTACGTGGGTCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828906 Original CRISPR AGGGCGGGGCCAGCTCAGGG GGG (reversed) Intronic
900121101 1:1049077-1049099 GGGGCCGGGGCAGCTCAGGTGGG + Intronic
900121126 1:1049125-1049147 GGGGCCGGGGCAGCTCAGGTGGG + Intronic
900151922 1:1182589-1182611 AGGGCTGGGCCTGGTCTGGGTGG + Intronic
900184038 1:1324768-1324790 AGGGCGGGGCGAGGGCGGGGCGG + Exonic
900240755 1:1616177-1616199 GGGGCGGGGCGCGCTCCGGGTGG + Intronic
900269327 1:1778903-1778925 CGGGCGGGGCCAGCTCTCGCGGG - Intronic
900349484 1:2227952-2227974 GGGGCGGGGCCGGCGCGGGGCGG + Intergenic
900408292 1:2501972-2501994 GGGGCTGGGCCACCTCAGGCTGG - Intronic
900432925 1:2611459-2611481 TGGGCGGGGCAAGGTCAGGGTGG + Intronic
900637286 1:3672163-3672185 AGGGTGGGGACATCTCAGAGTGG + Intronic
900645416 1:3706696-3706718 AGGGAGGCCCCAGCTGAGGGAGG - Intronic
900894732 1:5475190-5475212 AGGCCAGGGCGAGCACAGGGTGG - Intergenic
901080260 1:6580104-6580126 CCAGTGGGGCCAGCTCAGGGAGG + Exonic
901196210 1:7441386-7441408 AGGACTGGCCCAGCCCAGGGCGG - Intronic
901237060 1:7672861-7672883 AGGGCTGGGCCAGCAGGGGGTGG - Intronic
901846290 1:11984802-11984824 AGAGAGAGGCCTGCTCAGGGAGG + Intronic
901853494 1:12030156-12030178 AGGGCGGGGCTGGCTCAGACTGG + Intronic
901932405 1:12603874-12603896 AAGCCAGGGCAAGCTCAGGGTGG - Intronic
903269978 1:22181919-22181941 AGGCAGGGGGCAGATCAGGGAGG - Intergenic
903347304 1:22694966-22694988 AGGGTGTGGCCAGCGCAGAGAGG + Intergenic
903741965 1:25563582-25563604 AGGGCCAGGACAGCCCAGGGAGG + Intronic
903754896 1:25653782-25653804 AGAGCAGGGCCAGGTCGGGGCGG + Intronic
903806497 1:26009401-26009423 AGGGAGGGGCCAGCGCTTGGCGG + Intergenic
904006564 1:27366223-27366245 GGGGCGGGGCCGGATCCGGGCGG - Intronic
904007273 1:27369989-27370011 AAGGCGGGGGGAGCGCAGGGAGG - Intronic
904467761 1:30718422-30718444 GGGGCGGGGCCAGAGCAGGCAGG - Intronic
904811243 1:33164700-33164722 AGGGCTGGGCCACCTCTGGAGGG + Intronic
904913141 1:33950282-33950304 TGGGTGGGGCTAGCTCATGGAGG - Intronic
905013227 1:34760767-34760789 AGGGCTGGGCCAGGGCAGGAGGG - Intronic
905183235 1:36179051-36179073 TGGGCGGGGCCTGGGCAGGGCGG + Intronic
905326996 1:37160234-37160256 AGGTTGGGGCCAGCTCATGGAGG + Intergenic
905627714 1:39499312-39499334 ATGGCAGGGCCAGCGCAGGGAGG + Intronic
905668710 1:39777796-39777818 ATGGCAGGGCCAGCGAAGGGAGG - Intronic
905733434 1:40311461-40311483 GGGGCGGGGCTAACACAGGGGGG - Intronic
906219114 1:44064002-44064024 AGTGCGGGGCCAGAGCAGAGTGG + Intergenic
906488183 1:46247535-46247557 AGGGCGGGGCCAACAGAGGTGGG - Intergenic
907271939 1:53296410-53296432 AGGCCTGGGCCAGCACAGGGTGG + Intronic
908246015 1:62228290-62228312 AGGGCTGGTCCAGCCCAGTGTGG - Intergenic
908343071 1:63202892-63202914 AGGGAGGAGCCAGCTTAGGCAGG - Intergenic
913958126 1:143321379-143321401 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
913958262 1:143321848-143321870 AGGGCAGGGCCAGGGCAGGGCGG + Intergenic
914052441 1:144146754-144146776 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
914052577 1:144147223-144147245 AGGGCAGGGCCAGGGCAGGGCGG + Intergenic
914126620 1:144819318-144819340 AGGGCAGGGCCAGGGCAGGGCGG - Intergenic
914126756 1:144819787-144819809 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
915891987 1:159781373-159781395 CGGGCGGGGTCAGCGCAGGGAGG + Intronic
916720812 1:167483708-167483730 AGGGCAGTGCCTGCTCTGGGAGG + Intronic
918181086 1:182086435-182086457 CTGGCGGGGCCAGCTCCTGGTGG + Intergenic
920216467 1:204364690-204364712 AGGGCAGGGGCAACACAGGGGGG - Intronic
921053460 1:211527090-211527112 AGGGCAGGGCGAGCTTAGGTTGG - Intergenic
921838190 1:219799751-219799773 AGGGCGGGGAGTGCGCAGGGTGG + Intronic
922677593 1:227562046-227562068 TGGGCTGGGCCAGAACAGGGTGG - Intergenic
924645348 1:245872452-245872474 TGGGGTCGGCCAGCTCAGGGAGG - Intronic
1063022780 10:2146354-2146376 CGTGCGGGCCCAGCTCAGGCCGG + Intergenic
1063098117 10:2926137-2926159 AGGCAGGGGACAGCTGAGGGAGG + Intergenic
1064195072 10:13237719-13237741 AGGGCAGGGGCAGCTGAAGGTGG - Intergenic
1066759550 10:38739199-38739221 AGGGCAGGGCAAGGGCAGGGTGG - Intergenic
1067527026 10:47045227-47045249 AGGACAGGGTCAGCGCAGGGAGG + Intergenic
1067772077 10:49133844-49133866 AGGGCTGGTCAAGCTGAGGGTGG + Exonic
1067807007 10:49399320-49399342 AGAGAGAAGCCAGCTCAGGGTGG + Intergenic
1069874259 10:71551989-71552011 TGGGCGGGGACAGCCCAAGGAGG - Intronic
1070313285 10:75288972-75288994 AGAGCTGGGCCAGTTCAGAGAGG - Intergenic
1070722817 10:78768346-78768368 GGGGTGGGGGCAGCTGAGGGCGG + Intergenic
1071566818 10:86675351-86675373 AGGCTGGGGCCAGATCAGAGGGG - Intronic
1073289991 10:102408801-102408823 AGGGCGGTGCCAACCGAGGGCGG - Intronic
1073944381 10:108732740-108732762 AGGGCTGTGGAAGCTCAGGGCGG + Intergenic
1074214998 10:111375447-111375469 AGCTCTGGGCCTGCTCAGGGAGG - Intergenic
1074998489 10:118777955-118777977 AGGGCTGGGCCATCTCCGGTGGG - Intergenic
1075351112 10:121726000-121726022 ATGGCGGGGCCAGGGCAGGACGG + Intergenic
1076133389 10:128028825-128028847 AGGGCTGGGCCGGGGCAGGGTGG - Intronic
1076307311 10:129474331-129474353 AGGGCGGGGACAGTTCCAGGAGG + Intronic
1076850598 10:133090660-133090682 AGGCCGTGGCCAGGGCAGGGTGG + Intronic
1076898949 10:133327743-133327765 CCGGTGGGGCCAGCTCTGGGCGG + Intronic
1077000721 11:320936-320958 TGGCCGGGGCCAGATGAGGGCGG + Exonic
1077035891 11:494320-494342 AGGGCAGGCCCTGCCCAGGGTGG - Intergenic
1077087762 11:763207-763229 AGGGCGGGGGCAGGTGAGGGCGG - Intronic
1077087769 11:763223-763245 AGGGCGGGGGCGGGTGAGGGCGG - Intronic
1077087790 11:763270-763292 AGGGCGGGGGCGGGTGAGGGCGG - Intronic
1077087798 11:763286-763308 AGGGCGGGGACAGGTGAGGGCGG - Intronic
1077087810 11:763317-763339 GGGGCGGGGACAGGTGAGGGCGG - Intronic
1077147606 11:1052999-1053021 CAGGCGGGGCCAGTGCAGGGAGG - Intergenic
1077165081 11:1131200-1131222 ACTGCGGGGCCAGGCCAGGGTGG + Intergenic
1077242397 11:1517451-1517473 AGGACACGGCCAGCTGAGGGTGG - Intergenic
1077307853 11:1875938-1875960 AGGGAGGGGGCAGTCCAGGGAGG - Intronic
1077320498 11:1938793-1938815 TCCGCGGGGCCAGCTCAGGAGGG + Intergenic
1077320507 11:1938828-1938850 CGCGCAGGGCCAGCTCAGGAGGG + Intergenic
1077508678 11:2943899-2943921 AGGGCGGGGCCAGCCACGTGGGG + Intergenic
1078106747 11:8362714-8362736 AGGGCAGGAGCTGCTCAGGGAGG - Intergenic
1078341612 11:10501378-10501400 AGCTCAGGGCCAGCTCCGGGGGG - Intronic
1079320570 11:19448205-19448227 AGGTGGGGGCCAGCCCTGGGAGG + Intronic
1079320747 11:19449548-19449570 AGGTGGGGGCCAGCCCTGGGAGG - Intronic
1080608638 11:33885456-33885478 AGGGAGTGGCCTGCTCATGGGGG + Intronic
1080836535 11:35945037-35945059 AGGGCGGGCCCAGTCCAGGAGGG - Intronic
1082848674 11:57746058-57746080 CGGGAGAGGCCAGCTCAGGGTGG - Exonic
1083314972 11:61809050-61809072 AGGGAGGGGCCAGATCATGTAGG - Intronic
1083340815 11:61957319-61957341 AGGTGGGGGCGAGCCCAGGGTGG + Intronic
1083571265 11:63763344-63763366 AGGGCCGGGCGAGCACAGGGCGG + Exonic
1083613039 11:64013461-64013483 TGGGCGGGGCCTGTCCAGGGAGG + Intronic
1083778400 11:64905910-64905932 AGGCAGGGGCCAGGACAGGGAGG - Intronic
1083804529 11:65066139-65066161 AGGGCAGGGCCATGTCGGGGAGG + Intergenic
1083822624 11:65181680-65181702 GGGGAGGGGCCAGCGCGGGGGGG - Exonic
1084000165 11:66291804-66291826 GGGGCGGGGTCAGCGGAGGGCGG + Intergenic
1084020740 11:66416224-66416246 AGGGCATGGCCAGCTGAGGTTGG - Intergenic
1084431862 11:69115749-69115771 ACGGCGGTGCCAGGACAGGGAGG + Intergenic
1084472688 11:69372345-69372367 AGGGCATGGCCAGGACAGGGAGG + Intergenic
1084935496 11:72584505-72584527 GGGGCGGGGCCTGCGCCGGGCGG - Intronic
1085157753 11:74311702-74311724 AGGGCGGGGCCTGAGCCGGGAGG - Intergenic
1085294196 11:75421481-75421503 AGGGAGGGGTGAGCTCAGAGAGG - Intronic
1085318101 11:75558146-75558168 AGGGGCGGGCCTGCTCTGGGAGG + Intergenic
1085453518 11:76653186-76653208 AGGGAGGGGCCAGGGCTGGGGGG + Intergenic
1085560972 11:77473255-77473277 GGGGCGGGGCCAGGCCAGGCTGG - Intronic
1087269095 11:96092859-96092881 AATGCGGGGCCAGCTGATGGGGG + Exonic
1089432742 11:118436815-118436837 AGGGCCGGCCCTGCTCCGGGTGG + Exonic
1089790118 11:120936839-120936861 AGGTGGGGGCCAGGCCAGGGAGG - Intronic
1096111259 12:49030660-49030682 TGGGCAGAGCCAGCTGAGGGGGG - Exonic
1096154267 12:49333040-49333062 GGGGCGGGGCCGGCTCAGTCGGG + Exonic
1096718152 12:53503224-53503246 AGGAAGAGGCCAGGTCAGGGTGG - Intronic
1096975795 12:55698675-55698697 AGGGCCGTGCCACCTGAGGGAGG - Intronic
1097108011 12:56636401-56636423 AGGGCGGGGCTTTCTCTGGGTGG + Intronic
1098834472 12:75405446-75405468 AGGGCTGTGGAAGCTCAGGGTGG - Intronic
1102084385 12:110124262-110124284 GGGGCGGGGCCGGGCCAGGGCGG - Intergenic
1102461392 12:113101884-113101906 GGGGCGGGACCAGCTCAGGTGGG - Exonic
1103166491 12:118774426-118774448 ACGGCGGAGCCGGCTCCGGGCGG - Intergenic
1103325510 12:120117267-120117289 GGGCCGGGGCCAGCTCCGCGGGG - Intronic
1103610990 12:122124192-122124214 AGGAGGGGGACAGCTGAGGGCGG - Intronic
1103720834 12:122974627-122974649 AGGGCGGGGTCAGGTGTGGGAGG - Exonic
1104394479 12:128420466-128420488 AGGGGGAGGCGAGCTCAGAGGGG + Intronic
1104697094 12:130872006-130872028 GGGGCGGGGCCGGCGCGGGGCGG - Exonic
1104789265 12:131471737-131471759 ATGGAGGGGCCGGCTCTGGGAGG - Intergenic
1105402834 13:20110829-20110851 AGGGTGGGGTCACGTCAGGGAGG - Intergenic
1105512301 13:21061138-21061160 CGGGCGGGGGCGGCTCCGGGCGG + Intronic
1105812653 13:24008669-24008691 AGGCCTGGGCCAGCTGAGGAAGG + Intronic
1107015368 13:35704667-35704689 ATGCCTGTGCCAGCTCAGGGAGG - Intergenic
1107189170 13:37559145-37559167 AGGGCTGTGGAAGCTCAGGGGGG + Intergenic
1110450857 13:75636277-75636299 GGGGCGGGGCCACCGCGGGGAGG + Intronic
1113460149 13:110476588-110476610 AGGGCTGGTCCAGGACAGGGAGG - Intronic
1113707811 13:112445638-112445660 AGGGCGGGGAGAGCCCGGGGAGG - Intergenic
1113933765 13:113982365-113982387 AGGGCTGGCCGAGCACAGGGCGG + Intronic
1114477520 14:23007284-23007306 GGGGAGGGGCCTCCTCAGGGAGG + Intronic
1116945439 14:50831157-50831179 AGGGCCGGGCCCGCGCGGGGAGG + Intergenic
1117018055 14:51539259-51539281 GAGGTGGGGGCAGCTCAGGGAGG - Intronic
1118633794 14:67729231-67729253 AGTGCCGGACCAGCTCAGAGCGG - Exonic
1118865037 14:69696132-69696154 AAGCCGGGGCCTGCTGAGGGGGG - Intronic
1118971608 14:70642246-70642268 AGCGAGGGGCCAGGTCGGGGCGG + Exonic
1121201501 14:92121926-92121948 AGGGCGAGACCATCTCCGGGGGG - Exonic
1121273367 14:92652096-92652118 AGGCCTGGGCCCCCTCAGGGAGG + Exonic
1121302312 14:92881426-92881448 AGGGTGGGGCAGGCACAGGGAGG + Intergenic
1121518946 14:94572480-94572502 AGGGGGTGACCAGATCAGGGAGG - Intronic
1122043669 14:99008361-99008383 CTGGCGGGACCAGCTTAGGGTGG - Intergenic
1122156514 14:99753400-99753422 AGGGCGGGTCCTGGGCAGGGAGG - Intronic
1122428003 14:101622865-101622887 AGAGCCGGGGCAGCCCAGGGAGG + Intergenic
1122747870 14:103910369-103910391 TGGGCAGGGCCAGTTCAGGAAGG - Intergenic
1122773635 14:104107822-104107844 GGGGCGGGGCCAGCACTGGTGGG + Intronic
1122779707 14:104138520-104138542 AGGGCGGGGCCGGGGAAGGGCGG - Intergenic
1122787717 14:104171636-104171658 AGGAGGGGCCCAGCTCAGGTGGG - Intronic
1123071465 14:105644474-105644496 GGTGAGAGGCCAGCTCAGGGAGG - Intergenic
1202930285 14_KI270725v1_random:28786-28808 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1123422098 15:20142731-20142753 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1123442983 15:20303903-20303925 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1123531326 15:21149271-21149293 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1124640254 15:31392435-31392457 AGGGCGGGGCCACATCAGGAGGG - Intronic
1125535796 15:40440836-40440858 CTGGCGGAGCCAGCGCAGGGCGG + Intronic
1125581776 15:40790962-40790984 AGGGCCTGACCAGCTCTGGGTGG - Intronic
1125889425 15:43254590-43254612 AGGTTGGGGCCAGATCTGGGAGG - Intronic
1128309743 15:66622485-66622507 AGGGAGGGGGCATCTTAGGGCGG - Intronic
1128309751 15:66622501-66622523 GGGGCGTGGGCAGCCCAGGGAGG - Intronic
1130320261 15:82835640-82835662 AGGCCTGGGCCAGCACAGTGAGG - Exonic
1130421099 15:83747872-83747894 TGGACGAGGGCAGCTCAGGGTGG + Intronic
1131546366 15:93319303-93319325 AGGGTGGGGCCGGCAGAGGGTGG - Intergenic
1131559650 15:93428359-93428381 AGGGTGTGGCCAGCTAAGAGGGG + Intergenic
1132110037 15:99096228-99096250 AGTACTGGGCCAGCTCAGGAAGG + Intergenic
1132186685 15:99806956-99806978 GGGGCGGGGCCAGCTGAGGGAGG - Intergenic
1132304961 15:100804352-100804374 AGGAAGGTGCCAGCTCAGGTAGG - Intergenic
1132429002 15:101745755-101745777 GGGGCGGGGCCAGCTGAGGGAGG + Intergenic
1132478545 16:154246-154268 GGGGCGGGGGCGGCTCAGTGAGG - Intronic
1132480723 16:165002-165024 GGGGCGGGGGCGGCTCAGTGCGG - Intronic
1132506827 16:314369-314391 AGAGCGCGGCCAGCTCAGAGGGG - Intronic
1132552644 16:559843-559865 AGGGCAGGGCTCGCCCAGGGAGG + Intergenic
1132569303 16:637158-637180 GGGGCGGGGCCATATCGGGGCGG + Intronic
1132597421 16:759674-759696 AGGGAGAGGCCAGCTCCGAGTGG - Intronic
1132668071 16:1090932-1090954 AGGGTGGGGCCAGCCGAGGAGGG - Intronic
1132690693 16:1180659-1180681 AGGGAGGGGCCTGGGCAGGGCGG + Intronic
1132734723 16:1379701-1379723 GGGGCGGGGCCAGCGCGGAGGGG - Intronic
1133020646 16:2965312-2965334 TGGGCGGGGCCTGGTCAGAGCGG + Intronic
1133279555 16:4657420-4657442 GGGGTGGGGCCAGCACAGTGGGG + Intronic
1134058228 16:11183242-11183264 AGGGCGGGGCCAGCAAGGGCAGG + Intergenic
1134569925 16:15282254-15282276 AGGCAGGGGCTAGCTCAGGCAGG + Intergenic
1134732452 16:16473798-16473820 AGGCAGGGGCTAGCTCAGGCAGG - Intergenic
1134934985 16:18238168-18238190 AGGCAGGGGCTAGCTCAGGCAGG + Intergenic
1135686556 16:24502515-24502537 ATGGTGGGGCCAGCCAAGGGTGG + Intergenic
1136464046 16:30429851-30429873 AGGCCTGGCCCAGCTCGGGGTGG - Intronic
1136535002 16:30894050-30894072 AGGGCGCGGCCAACTCCAGGGGG - Exonic
1136579313 16:31142360-31142382 AGGGCGGGGCCTGCGGAAGGCGG - Intronic
1136718265 16:32301779-32301801 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1136773701 16:32860367-32860389 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1136836639 16:33508049-33508071 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1136841574 16:33546042-33546064 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1136896911 16:34001152-34001174 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1137275893 16:46933228-46933250 AGGGAGGGGTGAGTTCAGGGTGG + Intergenic
1138454940 16:57115774-57115796 AGGCAGGGGCCAGTGCAGGGAGG - Intronic
1138656088 16:58492287-58492309 AGTGCGGGCCCAGCTGAGGGAGG - Intronic
1138657607 16:58500159-58500181 AGGGCGGGGGCAGCTCGAGTGGG - Intronic
1139285896 16:65813841-65813863 AGGGCGGGGGTAGGTCAGTGAGG - Intergenic
1139474207 16:67194478-67194500 CAGGCGGGGTCAGCTGAGGGCGG + Intronic
1139549832 16:67667024-67667046 GGGGCAGGGACAGCTCACGGAGG + Exonic
1139563592 16:67758981-67759003 AGGGTGCTGCCAGCCCAGGGAGG + Intronic
1139917823 16:70439086-70439108 AGGGCGGGACTAGCCCACGGCGG - Intronic
1140279564 16:73542273-73542295 GGGGCGGGGGCTGCACAGGGTGG + Intergenic
1140486808 16:75299991-75300013 AGGCAGGGGACAGCTCGGGGAGG + Intronic
1141639542 16:85333371-85333393 TGGGCTGGGCCAGCACGGGGTGG - Intergenic
1141665955 16:85465215-85465237 TGGGCGGGGGCAGCCCATGGAGG - Intergenic
1142214482 16:88823930-88823952 GGTGCGGGGCCTGCACAGGGTGG + Intronic
1142293255 16:89202070-89202092 CGGGCGGGGCGAGGTCGGGGAGG + Intergenic
1142299447 16:89247800-89247822 CGGGCGGGGCGAGGTCGGGGAGG + Intergenic
1142378781 16:89720669-89720691 AGGACGGGGCCGGCTCGGGCTGG - Intronic
1203008163 16_KI270728v1_random:215986-216008 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1203076119 16_KI270728v1_random:1122478-1122500 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1203146824 16_KI270728v1_random:1808350-1808372 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1203151739 16_KI270728v1_random:1846339-1846361 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1142774881 17:2129231-2129253 TGGGAGGGGCAAGCCCAGGGAGG + Intronic
1142848364 17:2692705-2692727 GGGGCGGAGACAGGTCAGGGTGG + Intronic
1142995020 17:3755072-3755094 AGGGCGGGGCCACCTGATGAGGG - Intronic
1142995027 17:3755091-3755113 AGGGCGGGGCCACCTGATGAGGG - Intronic
1143270501 17:5671538-5671560 AGAGCAGGGCCACCTCAGGTAGG - Intergenic
1144574166 17:16418459-16418481 GGGGCGGGGCCTGCCCAGTGAGG + Intronic
1144849170 17:18235462-18235484 AGTGATGGGCCAGCTCTGGGAGG - Exonic
1146160951 17:30559357-30559379 AGGGGGCGGCCAGAACAGGGTGG - Exonic
1146488923 17:33265945-33265967 GGAGTGGGGCCAGCTCAGGTGGG - Intronic
1146957132 17:36942386-36942408 GGGGCGCGGCCAGGTCGGGGCGG + Intronic
1147130065 17:38402382-38402404 AGGGACGGGCCTGGTCAGGGAGG - Exonic
1147313157 17:39606758-39606780 AGGGCTGGGCCGGCTCTGGGCGG - Intronic
1147325060 17:39666139-39666161 AGGAAGGGCCCAGCCCAGGGCGG - Exonic
1148027637 17:44599733-44599755 AGGGCAGAGCTGGCTCAGGGAGG + Intergenic
1148124518 17:45229966-45229988 AGGGCTGGGGGAGCTGAGGGCGG - Intronic
1148617905 17:49014142-49014164 AGGGCGGCGGCAGCTGAGGCGGG - Intronic
1148621164 17:49035762-49035784 GGGGCGGGCCCGGGTCAGGGAGG - Intronic
1148741731 17:49897090-49897112 AGGGTGGGGCCAGCCCTGAGGGG - Intergenic
1150249710 17:63699089-63699111 AGGGCAGGGGCAGCTCCGGGAGG + Intronic
1150621606 17:66812016-66812038 AGGTCAGGGCCAGCCCAGTGGGG - Intergenic
1151350534 17:73529235-73529257 AGGTTGGGGACAGCTGAGGGAGG + Intronic
1151728340 17:75897029-75897051 GGGGCGGGGCGAGATCCGGGCGG + Intergenic
1151747967 17:76021832-76021854 AGGTCGGGGCCAGGTGGGGGCGG - Intronic
1152368145 17:79869337-79869359 AGGGAGGGGGCATCCCAGGGAGG - Intergenic
1152433705 17:80262817-80262839 AGGGCAGGGCCAGGGCAGGGAGG + Intronic
1152460183 17:80438417-80438439 AGGGTGGGGACAGGGCAGGGGGG - Intergenic
1152642085 17:81453595-81453617 AGGGCAGGGGCAGCTCTGGGGGG - Intronic
1152745479 17:82036825-82036847 AGGGCGGAGGAACCTCAGGGAGG - Intronic
1152812066 17:82386812-82386834 AGGGAGGGCCCAGAGCAGGGAGG + Intergenic
1152867352 17:82732196-82732218 ATGGAGGGGCCAGGACAGGGTGG + Intergenic
1152887871 17:82863149-82863171 ACGGTGGGGCCAGCACATGGAGG - Intronic
1153006186 18:500483-500505 AGGGCGGCGGCAGCTCCGCGGGG - Intronic
1153225116 18:2894041-2894063 AGAGCGGAACCAGGTCAGGGAGG - Intronic
1160522169 18:79513946-79513968 AGTGAGCGGCCAGCTCAGGTGGG - Intronic
1160857637 19:1224525-1224547 AGGGCAGGGCCAGCCCAGGCAGG + Intronic
1160948106 19:1652640-1652662 GGGGCGGGGCCTGCACGGGGCGG - Intergenic
1161146807 19:2683802-2683824 AGGGACGGGCCAGCTCGGGCAGG + Intronic
1161313343 19:3606904-3606926 GGGGCGTGGCCAGCGCAGGGTGG - Intergenic
1161703502 19:5807001-5807023 AGGGCTGGGGAAGCTCAGAGTGG + Intergenic
1161967222 19:7555355-7555377 GGGGCGGGGCCAGGTGAGGGCGG + Exonic
1162340946 19:10091408-10091430 AGGGTGGGGCCAGGGCAGGGAGG - Intronic
1162725972 19:12689889-12689911 AGGGACGGGACAGCTCAGGCCGG + Intronic
1162951111 19:14072658-14072680 AGGGCGGGGCCAGGGCGGGGCGG + Intronic
1163012743 19:14435303-14435325 AGAGCGGGGCCAGCTCAACTGGG - Intronic
1163591174 19:18194912-18194934 GGGGCGGGGCCAGAGCTGGGCGG - Intronic
1163653444 19:18532063-18532085 AGGAGGGGGCCAGACCAGGGAGG + Exonic
1163770285 19:19186895-19186917 TGTGCTGGGCCAGCTCGGGGAGG + Exonic
1164115616 19:22215968-22215990 AGGCCTGGCTCAGCTCAGGGAGG - Intergenic
1164646734 19:29863759-29863781 TGGGTGAGGCCAGCTCACGGTGG + Intergenic
1165383235 19:35495504-35495526 AGCGCGGGGCCCTCCCAGGGAGG - Intronic
1165395994 19:35563783-35563805 AGGGGGGGGCCAGCCCAGGAGGG - Intergenic
1165418975 19:35713372-35713394 GGGGCGGGGCTAGCTCCAGGGGG + Intronic
1165448225 19:35868483-35868505 AAGGCGGGGCCGGCGCGGGGCGG + Exonic
1165738851 19:38193885-38193907 GTGTCGGGGCCATCTCAGGGAGG + Intronic
1165750481 19:38256411-38256433 AGGGCGGGGCTAGCCGGGGGCGG + Exonic
1166130422 19:40742678-40742700 AGGGCGTGCCCAGCACTGGGTGG + Exonic
1166304924 19:41932286-41932308 AGGGTGGGCCCTGCTCTGGGAGG - Intergenic
1166367177 19:42283844-42283866 AGGGCGGGGCGGGCTCCGGTTGG - Intronic
1167251338 19:48399880-48399902 GGGGCGGGGCCAGCGAGGGGCGG + Intronic
1167384944 19:49157731-49157753 GGGGCGGGGCGAGGTCTGGGGGG - Exonic
1167445289 19:49533886-49533908 AGGGCGGGGCCGGCGCGGAGAGG + Intronic
1167645365 19:50702698-50702720 AGGGAGGGGACACCTCTGGGAGG + Intronic
1167877837 19:52429082-52429104 AGGGCAGGGCCGGGACAGGGCGG - Intergenic
1168076123 19:53981805-53981827 AGGCCTGGGCCAGCTAAGAGTGG + Intronic
1202691839 1_KI270712v1_random:99178-99200 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
925844130 2:8020424-8020446 AGGGAGGGGCCAGGCCATGGGGG + Intergenic
926121370 2:10242970-10242992 AGGGCTGGCCCGGCTCCGGGAGG + Intergenic
926202713 2:10812969-10812991 AAGGCGGGGCCTGCTGGGGGCGG + Intronic
926217871 2:10916131-10916153 TGAGCGGGGGAAGCTCAGGGAGG + Intergenic
927561369 2:24076573-24076595 AGGGCGGGGCCTGAGGAGGGCGG + Intronic
927815743 2:26215813-26215835 AGGAAGGGGCTAGCTCAGAGAGG + Intronic
928084252 2:28335854-28335876 GGACCGTGGCCAGCTCAGGGGGG + Intronic
928998827 2:37325231-37325253 AGGGCTGTGACATCTCAGGGTGG - Intergenic
929075483 2:38076217-38076239 AGGGCGGGGCCTGCGGGGGGCGG + Intronic
929452086 2:42044733-42044755 GGGCTGGGGCCAGCTCATGGAGG + Intergenic
929557134 2:42932425-42932447 AGGGCAGGCCCAGCTCAGGGAGG - Intergenic
931812915 2:65872460-65872482 AGGGAGTGTCCAGCTAAGGGAGG + Intergenic
931973685 2:67619079-67619101 AGGAAGGGGCCAGATCATGGAGG + Intergenic
932411402 2:71549979-71550001 AGGAAGGGGCCAGGACAGGGAGG - Intronic
932493533 2:72135614-72135636 TGGGCAGGGCCAGAGCAGGGCGG + Intronic
933677150 2:85066971-85066993 AGGACGGGGCCACGTGAGGGCGG + Intergenic
933954551 2:87354778-87354800 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
934238748 2:90250998-90251020 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
934274449 2:91565712-91565734 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
934461172 2:94214329-94214351 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
934795357 2:97094924-97094946 AGGGCGGGCCCAGTGCGGGGCGG + Intergenic
934933095 2:98444747-98444769 AGGGCGGACCCAGCTCGGGCTGG + Intergenic
935270851 2:101433022-101433044 AGGGCGGGGTCAGCTGGGGATGG + Intronic
938252602 2:129827462-129827484 CGGGCGGGGCCGGCTGAAGGGGG + Intergenic
938386131 2:130868609-130868631 AGGGAGAGGCCAGGTCAGGCAGG + Intronic
938440121 2:131322495-131322517 CAAGCGGGGCCAGCTTAGGGGGG - Intronic
941918570 2:170828153-170828175 AGGGCGAGGACAGCAGAGGGAGG - Intronic
941918622 2:170828387-170828409 AGGGTGGGGACAGCAGAGGGAGG - Intronic
941918706 2:170828737-170828759 AGGGCGAGGACAGCAGAGGGAGG - Intronic
942268253 2:174248709-174248731 AGGGCGGGAGGAGCCCAGGGTGG + Intergenic
942916318 2:181312040-181312062 AGGGTGGGGCGTGATCAGGGAGG + Intergenic
944058514 2:195547630-195547652 AGGCCAGCGCCAGCTCCGGGTGG - Intergenic
944495831 2:200306760-200306782 AGCGCGGGGCGAGCTCCGGACGG + Intronic
947567554 2:231204292-231204314 GGGCCGGGGCCAGGTCAGGTGGG - Intronic
947752139 2:232538736-232538758 AGGGAGGGGGAAGCTCAGGAAGG + Intergenic
947752145 2:232538752-232538774 AGGAAGGGGGAAGCTCAGGGAGG + Intergenic
947752165 2:232538832-232538854 AGGGAGGGAGAAGCTCAGGGAGG + Intergenic
947752171 2:232538848-232538870 AGGGAGGGGGAAGCTCTGGGAGG + Intergenic
947841107 2:233208522-233208544 AGGGCGGGGACACCTGAGTGGGG - Intergenic
947988167 2:234466221-234466243 AGGGAGGGGCGGGCACAGGGTGG + Intergenic
948645437 2:239401114-239401136 AGGGCGGGGCCCGCAAGGGGAGG - Intronic
948694850 2:239728074-239728096 AGGGTGGGGGCATCTCGGGGAGG - Intergenic
948831608 2:240601080-240601102 AGGGCCTGGCCAGCCCAGGTGGG - Intronic
1168771059 20:417257-417279 AGGGAGGTGCCAGATCATGGAGG + Intronic
1169093120 20:2873383-2873405 AGGGCGGGGCCCGCGCGGGCCGG + Intronic
1171866003 20:30488066-30488088 AGGGAGGGAGCAGCTCGGGGTGG + Intergenic
1172252544 20:33490049-33490071 GGGGCGGGGCCAGCCGGGGGCGG + Intergenic
1172762457 20:37332135-37332157 AGGGCCCCGCCAGCTCAGGGAGG - Intergenic
1173190982 20:40875425-40875447 GGGGCGGGGGAAGCTCAGGGAGG - Intergenic
1173249005 20:41354762-41354784 GGGCCAGGGCCAGCACAGGGCGG + Intronic
1173821478 20:46022687-46022709 TGGGAGGAGCCAGCTCAGGCGGG + Intronic
1173939081 20:46894792-46894814 AGGGAGGGCCCGGCCCAGGGAGG + Exonic
1174421146 20:50399911-50399933 GGGGCTGGGCCAGGGCAGGGAGG - Intergenic
1175215818 20:57391321-57391343 GGGGCGGGGCCGGCTGGGGGCGG + Intergenic
1175349565 20:58309039-58309061 TGGGCGGGGCGGGCTGAGGGTGG - Intergenic
1175429508 20:58891631-58891653 AGGGCCGGGGCAGCGCCGGGCGG - Intronic
1175733518 20:61370203-61370225 AGGGAGGAGCCAGGTCAAGGAGG + Intronic
1175858297 20:62134626-62134648 CAGGCAGGGCCAGCACAGGGTGG + Exonic
1175939450 20:62531324-62531346 AGGGAGGGGCAGGCTCAGGGAGG - Intergenic
1176053182 20:63131259-63131281 AGGGTGGGTGCAGCTCAGGGAGG + Intergenic
1176592297 21:8657368-8657390 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1176858404 21:13987757-13987779 AGGGTGGGGCCAGGGCAGGGCGG - Intergenic
1178163006 21:29940041-29940063 AGGGTGGGGCCAGCGAGGGGAGG - Intergenic
1179152801 21:38822901-38822923 AGCCTGGGGCCGGCTCAGGGTGG - Exonic
1179337832 21:40474565-40474587 GGGGCTGTTCCAGCTCAGGGGGG - Intronic
1179435926 21:41362059-41362081 AGAGCGGGGCCGGTGCAGGGAGG + Intronic
1179544992 21:42107811-42107833 TGGGTGGGGCCAGCTCAGGAGGG + Intronic
1179949153 21:44699915-44699937 ATGGCAGGGCCAGGGCAGGGCGG - Intronic
1180275148 22:10634497-10634519 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1180549621 22:16529431-16529453 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1180754364 22:18150107-18150129 AGCGCGGGGCCAGACCAAGGCGG + Exonic
1180980825 22:19877258-19877280 CAGGCGGGGTCAGCACAGGGAGG + Intronic
1181039016 22:20183244-20183266 AGGGCTGAGCCAGGTCAGCGTGG - Intergenic
1181051472 22:20240177-20240199 AGGCTGGGGGCAGCTCAGGCAGG - Intergenic
1181364968 22:22369456-22369478 TGTGGGGGGCCAGCCCAGGGTGG - Intergenic
1181368035 22:22394860-22394882 TGTGAGGGGCCAGCCCAGGGAGG - Intergenic
1181491379 22:23262706-23262728 AGGGCGGGCCCGGGTGAGGGCGG + Intronic
1181946361 22:26520739-26520761 AGGACGTGGCCATCTCAGGGTGG - Intergenic
1182123660 22:27801624-27801646 GGCGCGGGGGCAGCTCTGGGGGG + Intergenic
1182409447 22:30170763-30170785 AGGGAGGGACCAACTCAGGCTGG - Intronic
1182792732 22:32966455-32966477 AGGCAGGGGCAAGCTCATGGAGG + Intronic
1183078439 22:35441334-35441356 AGGGTGGGCTCAGCTCAGGGAGG + Intergenic
1183311466 22:37112159-37112181 AGGGCTGGGCCAGGGCAGGAGGG + Intergenic
1183687114 22:39367485-39367507 TGGGCGGGGCCAGCACATGAAGG + Intronic
1184199875 22:42961049-42961071 AGGGCAGGGCCAGTTCAGGGCGG + Intronic
1184278944 22:43426370-43426392 AGGGAGGTGACAGCACAGGGAGG + Intronic
1184523152 22:45007571-45007593 AGGGAGGGGGCAGCGGAGGGAGG + Intronic
1184614593 22:45629615-45629637 GGGGCGGGGACAGCAGAGGGCGG - Intergenic
1184658640 22:45955206-45955228 AGGGCCAGGCCGGCTCGGGGAGG - Intronic
1184663382 22:45975782-45975804 AGCGCGGGGCCAGCAGCGGGCGG + Intronic
1184865016 22:47197440-47197462 AGGGCGGGGGCGGCCCAGGCAGG - Intergenic
1184925295 22:47632220-47632242 AGCCCGGGGCCAGCTTTGGGAGG + Intergenic
1185222056 22:49634114-49634136 TGGGAGGTGCCCGCTCAGGGAGG + Intronic
1185232766 22:49692972-49692994 AGGACGTGGCGAGCTCATGGTGG + Intergenic
950038279 3:9902803-9902825 AGGGCGGGGCCAGGGCAGGCTGG + Intronic
950345400 3:12288065-12288087 TGGGCGGGGAGTGCTCAGGGAGG + Intronic
950431449 3:12953360-12953382 AGGGCGGGGGCATGTCAGTGAGG - Intronic
950702273 3:14758698-14758720 AGGGAGGGGCCACTTCTGGGAGG - Intronic
952829926 3:37556132-37556154 GGGGCTGGGCCAGGCCAGGGTGG + Intronic
953079062 3:39598417-39598439 AGGGCAGGGCCTGCTCATGCAGG - Intergenic
953147788 3:40294749-40294771 AGAGTTGGGCCAGCTCAGGGTGG - Intergenic
953184095 3:40621906-40621928 AGGGAGGGACAAGTTCAGGGTGG + Intergenic
953565253 3:44026905-44026927 AGGCAGGGGCCAGCTCCTGGAGG - Intergenic
953598501 3:44339713-44339735 GGGGCGGGGAGAGCTCAGGAAGG - Intronic
953911241 3:46894051-46894073 AGGGAGGGGCCAGTCAAGGGCGG + Intronic
954137678 3:48589561-48589583 TGGGAGGGGGCAGGTCAGGGTGG - Intronic
954626550 3:52025065-52025087 AGGGGTGGGTGAGCTCAGGGAGG - Intergenic
954674574 3:52308747-52308769 AGAGTGGGGCCAGATCAGGGAGG + Intergenic
959085629 3:101849111-101849133 AGGGCTGGGCCTGCAGAGGGAGG - Intronic
959622753 3:108415841-108415863 AGGCTGGAGCCAGATCAGGGGGG + Intronic
961359408 3:126357536-126357558 AGGGCGGGGCCAGGGCGGGGCGG - Intergenic
961447878 3:126989537-126989559 ACGGCCGGGCCGGCTCAGGTAGG - Exonic
961495476 3:127288110-127288132 GGGGCGGGGCCAGCTGGGGCAGG + Intergenic
962770926 3:138609252-138609274 GGCGCGGGGCCAGCCCGGGGCGG + Intronic
964845593 3:161041236-161041258 AGGGCGGGGCCAGTGGGGGGAGG - Intronic
966505088 3:180691869-180691891 AAGGAGGGGCCAGTTCAGGAAGG - Intronic
966816382 3:183893253-183893275 AGAGAGCTGCCAGCTCAGGGTGG + Intergenic
966816723 3:183895924-183895946 AGGGCTGGGGCTGCTCAGGCGGG + Intergenic
966883515 3:184362400-184362422 AGGGCGGAGCGCGCGCAGGGTGG + Intronic
966971851 3:185051572-185051594 AGCACAGGGCCAGCCCAGGGTGG + Intronic
968701648 4:2060505-2060527 AGGGCAGGGACAGGGCAGGGAGG - Intronic
969316941 4:6388139-6388161 AGGGAGGAGGCACCTCAGGGGGG - Intronic
969365188 4:6690109-6690131 AGGGCGGGGCCTGTGCTGGGGGG - Intergenic
969698197 4:8747874-8747896 TGGGCTGGGCTAGCTCTGGGAGG - Intergenic
969704054 4:8782552-8782574 AGGGCGGGGACAGATCAGAGAGG + Intergenic
971234697 4:24830254-24830276 AGGACGAAGCCAGCTCATGGAGG + Intronic
973638987 4:52885179-52885201 AGGGCGGGGCCAGAGGAGTGTGG - Intronic
975342703 4:73259011-73259033 ACGGCGGGGACAGATGAGGGGGG + Intergenic
979064300 4:116108787-116108809 TGAGCGGGGCCAGCTTATGGGGG - Intergenic
983570374 4:169201359-169201381 AGAGCGGGGCTAGGGCAGGGAGG + Intronic
983627810 4:169819752-169819774 AGGGCTGCACAAGCTCAGGGTGG - Intergenic
985445269 4:190018255-190018277 TGGGCTGGGCCAGAACAGGGGGG - Intergenic
985634811 5:1030826-1030848 AGGGCGGTGCCAAGGCAGGGTGG - Intronic
985746437 5:1651494-1651516 AGGGCAGGGCCAGAAAAGGGTGG + Intergenic
986403473 5:7402041-7402063 AGGGGTGAGCCAGTTCAGGGTGG - Intronic
987340650 5:16936312-16936334 AGGGCGGGGCCGGCTGCGGGAGG - Intergenic
987340659 5:16936332-16936354 AGGGCGGGGCCGGCTGCGGGAGG - Intergenic
992215284 5:74519305-74519327 GGGGCGGGGCAAGGACAGGGAGG - Intergenic
998252401 5:140561917-140561939 AGGGTGGGCCCAGCTCAGCAGGG - Intronic
999232386 5:150069438-150069460 AGCTCGGGGCCAGCTAAGGACGG - Intronic
1001070245 5:168579400-168579422 CGGGCGGGGCCGGCCTAGGGCGG + Exonic
1002789621 6:427654-427676 GGGGGTGGGCCAGCTCAGGCAGG + Intergenic
1002817446 6:693550-693572 AGGGCTGCACCAGGTCAGGGGGG + Intergenic
1004431232 6:15545930-15545952 ACTGCAGGGCCAGCTCAGGCAGG + Intronic
1006132996 6:31879888-31879910 AGGGAGGAACCAGCTCTGGGAGG + Exonic
1006717694 6:36130765-36130787 GGCGAGGGGCCAGCCCAGGGCGG - Intronic
1007586708 6:42995056-42995078 AGAGTGGGGCCAGCTCAGAGGGG - Intronic
1007625376 6:43243605-43243627 GGGGCGGGGGCGGCTCAGTGCGG - Intergenic
1007813048 6:44499806-44499828 AGGGAGGGGCCAACTCAGGTGGG + Intergenic
1008169703 6:48187832-48187854 AGGGCGAGGGGAGCTGAGGGAGG - Intergenic
1010813687 6:80329619-80329641 AGGGCAGCACCAGCACAGGGAGG - Intronic
1011044680 6:83068034-83068056 AGGGCGGCCCCAGGTGAGGGAGG + Intronic
1011443023 6:87407935-87407957 GGGGCGGGGCCAGGTGGGGGTGG - Intergenic
1013022841 6:106235998-106236020 AGGTCTGGGCCAGGTCAGGAGGG - Intronic
1014246830 6:119078554-119078576 GGGGCCGGGCCAGCTCTTGGAGG + Exonic
1015430742 6:133128064-133128086 AGGCAGGGGCCAGATGAGGGAGG + Intergenic
1018171016 6:161143015-161143037 AGGTCGGGAGCAGCTCTGGGTGG - Intronic
1018986068 6:168638068-168638090 AGGGCAGGGGCAGGGCAGGGTGG - Intronic
1019048042 6:169163014-169163036 GGGGCGGGGCCTACCCAGGGCGG - Intergenic
1019288130 7:233930-233952 TGGGTGTGGCCAGCTCTGGGGGG + Intronic
1019335473 7:480637-480659 AAGGCAGGGGCAGCTCAGGCAGG + Intergenic
1019562569 7:1665884-1665906 AGCGCGGGGCGAGCGCGGGGCGG - Intergenic
1019727803 7:2612579-2612601 TGGGCGGGGCGAGCTGTGGGTGG + Exonic
1019922066 7:4169367-4169389 AGGGCAGGGGCAGGTCTGGGTGG - Intronic
1020098753 7:5382673-5382695 AGGGTGGGGCCAGGTCTGGGAGG - Intronic
1020109377 7:5439642-5439664 AGGGGGGCCTCAGCTCAGGGAGG - Intronic
1022095695 7:27139696-27139718 CGGCCGGGGCCAGCTCCTGGGGG - Intronic
1025777793 7:64574487-64574509 AGGCCTGGCTCAGCTCAGGGAGG + Intergenic
1025825431 7:65006877-65006899 GGGCCTGGGTCAGCTCAGGGAGG - Intergenic
1026960523 7:74404648-74404670 AGGGCAGAGGCAGCTCAGAGTGG + Exonic
1028530849 7:91837114-91837136 AGGTAGGGGCCAGATCACGGAGG + Intronic
1028599830 7:92589927-92589949 ATGGCGGGGCCAGGTGTGGGGGG + Intronic
1029205932 7:98869514-98869536 AGGGCAGGGCCAGCCTGGGGGGG + Intronic
1029215337 7:98944505-98944527 AGGGAGGGTCCAGCTCTGTGAGG + Intronic
1029360971 7:100088594-100088616 AGGCCGGGGCCAGATCAGGCAGG + Intergenic
1031485392 7:122317279-122317301 AGGGCGGCGCCAGGCCAGGCTGG + Intergenic
1032121419 7:129159885-129159907 AGACCGGGGCCAGCTGAGTGTGG + Intronic
1032427022 7:131830533-131830555 GGGGAGGGGGCTGCTCAGGGAGG + Intergenic
1033520985 7:142160132-142160154 AGGGAGTGGCCATCTCATGGAGG + Intronic
1034528453 7:151680847-151680869 AGGGAGAGGACAGCTCAGGAAGG - Intronic
1035222487 7:157414336-157414358 AGGGCAGAGCCAGCTCTTGGAGG - Intronic
1035268303 7:157704525-157704547 AGGGCGGGCCCAGCCGAGGGTGG - Intronic
1035294834 7:157861152-157861174 AGGGATGTGCCAGCTCAGGGAGG + Intronic
1035518374 8:255829-255851 AGGGTGGGTCCTGCACAGGGGGG + Intergenic
1036910826 8:12755559-12755581 AGGGCGGGGCCTGGCGAGGGCGG + Intronic
1037589974 8:20304004-20304026 GGGGCGGGGCCGGCCCGGGGCGG + Intergenic
1037816915 8:22117194-22117216 GGGGCTGGGGCAGCTCAGGTTGG + Intronic
1037822565 8:22141962-22141984 GGGGCGGGGCGAGGTCAGGGAGG + Intergenic
1037828906 8:22176934-22176956 AGGGCGGGGCCAGCTCAGGGGGG - Intronic
1037980106 8:23247028-23247050 CGGGCGGGGGCAGCTCTCGGAGG + Intronic
1038486108 8:27936255-27936277 TGACCAGGGCCAGCTCAGGGAGG - Intronic
1039888649 8:41669950-41669972 AGGGTGAGGACATCTCAGGGAGG - Intronic
1039888859 8:41671166-41671188 AGGGCGGGGGCTTCTCAGTGCGG + Intronic
1039957934 8:42221562-42221584 GAGGCGGGGCCAGCTCCGAGAGG + Intergenic
1045231328 8:100309879-100309901 AGAGCGGCGGCAGCGCAGGGTGG + Intronic
1045368004 8:101493868-101493890 AGGGCGGGGGCCGGCCAGGGGGG - Intronic
1045583146 8:103500535-103500557 GTGGCGGGGACAGCTAAGGGTGG - Intergenic
1047514946 8:125545866-125545888 AGGGCTGGGCGAGTTCAGAGTGG + Intergenic
1049014179 8:139908021-139908043 AGGGCAGCACCAGCCCAGGGTGG + Intronic
1049385371 8:142340426-142340448 AGGGCTGGGGGAGCTGAGGGTGG + Intronic
1049389068 8:142358890-142358912 AGGGCTGGGCCAGCGCAGGATGG - Intronic
1049404644 8:142446983-142447005 AGGGTGGGCCCAGCACTGGGAGG - Intergenic
1049470420 8:142772857-142772879 GGGGCTGGGACAGGTCAGGGTGG + Intronic
1049548719 8:143246653-143246675 GAGGCGGGGCCCGCTCGGGGAGG + Intergenic
1049548744 8:143246729-143246751 GGGGCGGGGTCAGCTCGGGGAGG + Intergenic
1049548764 8:143246791-143246813 GGGGCGGGGCCTGATCGGGGCGG + Intergenic
1049747759 8:144270195-144270217 AGGGCAGAGCCAGCTCAGAGCGG + Intronic
1049772884 8:144391878-144391900 GGGGCGGGGGCGGGTCAGGGCGG + Intronic
1049796860 8:144500979-144501001 GGGGCGGGGCCTGCTGGGGGCGG - Intronic
1049812189 8:144580576-144580598 TGGGCAGGGCCAGGTGAGGGCGG - Intronic
1049812244 8:144580745-144580767 TGGGCGGGGCCAGGTGAGAGCGG - Intronic
1049812257 8:144580778-144580800 TGGGCGGGGCCAGGTGAGGCAGG - Intronic
1052749046 9:32469884-32469906 AGGGCGGACCCACCTCAGGCAGG + Intronic
1053150940 9:35742282-35742304 AGGGAGAGGCCAGCTCAAGAAGG - Intronic
1054273134 9:63047479-63047501 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1054302924 9:63390972-63390994 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1054401705 9:64717488-64717510 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1054435308 9:65201797-65201819 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1054495082 9:65819884-65819906 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic
1055415335 9:76076272-76076294 AGGCAGGGGCCAGCTCAGCAAGG + Intronic
1055864630 9:80798017-80798039 AGGGTGAGGCCAGCGCATGGAGG + Intergenic
1056493096 9:87127214-87127236 AGGCAGGGGCCAAATCAGGGAGG - Intergenic
1056740150 9:89247491-89247513 ATGGCAGGGCCAGCTAAGCGAGG + Intergenic
1057342286 9:94213722-94213744 TCGACGGGGCCAGCCCAGGGTGG - Intergenic
1057705260 9:97391182-97391204 AGGCCCGGGCCGGCGCAGGGTGG - Intergenic
1058851289 9:109013705-109013727 AGGGCGGGGCCATGTGGGGGCGG - Intergenic
1059115889 9:111599691-111599713 AGGGTGGGGCCACCCCAGGGCGG + Exonic
1059479298 9:114576017-114576039 AGGCAGGGGCCAGCTCAGTGGGG - Intergenic
1060189356 9:121582295-121582317 AGGTGGGGGCCAGGCCAGGGTGG + Intronic
1060661113 9:125405702-125405724 AGGGCAGGGCCAGGGCAGGCAGG + Intergenic
1060945672 9:127568472-127568494 TGGGCGGGGACAGCCAAGGGTGG + Intronic
1061017298 9:127989294-127989316 AGGGCAGGGCCAGCTCTCAGAGG - Intergenic
1061194235 9:129098743-129098765 TGGAGGGGGCCAGCCCAGGGAGG + Intronic
1061235772 9:129341771-129341793 TGGTTGGGGCCAGCTCAGGCAGG - Intergenic
1061275905 9:129569231-129569253 GGGCCGGGGCCAGGCCAGGGAGG + Intergenic
1061521443 9:131120592-131120614 GGGGCAGGGCCAGGGCAGGGAGG + Exonic
1062270671 9:135706915-135706937 AGGGCTGGGCCACTTTAGGGAGG - Intronic
1062377150 9:136267319-136267341 AGGGCGGGGCTACAGCAGGGCGG + Intergenic
1062393437 9:136343064-136343086 GGGGAGGGGCCAGCAGAGGGCGG - Intronic
1062396793 9:136355854-136355876 AGGGAGGGCCCGGCTGAGGGGGG - Intronic
1062398865 9:136363733-136363755 GGGGCGGGGCCGGGGCAGGGCGG - Exonic
1062423956 9:136497569-136497591 AGGGCGGGGGCCGGTGAGGGGGG + Intronic
1203745071 Un_GL000218v1:36960-36982 AGGGAGGGGTCAGCTGTGGGAGG - Intergenic
1203565037 Un_KI270744v1:82524-82546 AGGGAGGGGTCAGCTGTGGGAGG + Intergenic
1203622351 Un_KI270749v1:136215-136237 AGGGCAGGGCCAGGGCAGGGTGG - Intergenic
1185729419 X:2449300-2449322 AGGGCCGGGCCTGCTCAGGAGGG + Intronic
1185730814 X:2460227-2460249 AGGGCCGGGCCTGCTCAGGAGGG + Intronic
1185733759 X:2481774-2481796 AGGGCTGGGCCTGCTCAGGAGGG + Intronic
1189760508 X:44317124-44317146 AGGGCTGTGGAAGCTCAGGGGGG - Intronic
1200256479 X:154585546-154585568 AGGGCAGGGCCAGGTGGGGGAGG + Intronic
1200261290 X:154618857-154618879 AGGGCAGGGCCAGGTGGGGGAGG - Intronic
1202583257 Y:26403189-26403211 AGGGCAGGGCCAGGGCAGGGTGG + Intergenic