ID: 1037828907

View in Genome Browser
Species Human (GRCh38)
Location 8:22176935-22176957
Sequence GAGGGCGGGGCCAGCTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 415}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828907_1037828925 13 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828907_1037828921 10 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828907_1037828924 12 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1037828907_1037828917 -3 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828917 8:22176955-22176977 CTCCAGGTGCTGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 20
4: 151
1037828907_1037828920 7 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828920 8:22176965-22176987 TGCTCCTACGTGGGTCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 33
1037828907_1037828926 21 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828926 8:22176979-22177001 TCGCCGCGGCGGGGGCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218
1037828907_1037828923 11 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828907_1037828918 -2 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828918 8:22176956-22176978 TCCAGGTGCTGCTCCTACGTGGG 0: 1
1: 0
2: 1
3: 12
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828907 Original CRISPR GAGGGCGGGGCCAGCTCAGG GGG (reversed) Intronic
900087228 1:904415-904437 GAGGGCGGGGCCGGGGCCGGCGG - Intergenic
900121100 1:1049076-1049098 CGGGGCCGGGGCAGCTCAGGTGG + Intronic
900121125 1:1049124-1049146 GGGGGCCGGGGCAGCTCAGGTGG + Intronic
900188719 1:1344502-1344524 GCAGGCAGGGCCAGCCCAGGTGG + Intronic
900269328 1:1778904-1778926 GCGGGCGGGGCCAGCTCTCGCGG - Intronic
900310289 1:2030133-2030155 GAGGGGGCAGCCCGCTCAGGAGG + Exonic
900432906 1:2611406-2611428 GTGGGCGGGGCAAGGTCTGGTGG + Intronic
900802050 1:4743342-4743364 GAGGGCAGGGCCAGGGAAGGAGG + Intronic
901062247 1:6477130-6477152 GTGGGGGTGGCCAGGTCAGGAGG - Intronic
901433969 1:9234989-9235011 GAGGGCCGGGCCCGCTCCCGAGG - Exonic
901436770 1:9251334-9251356 GAGGGCCTGGCCAGCTGGGGAGG - Intronic
903280274 1:22246078-22246100 GAGGGAGGGGCCGGCTTTGGGGG + Intergenic
903971712 1:27123003-27123025 GCGGTGGGGGGCAGCTCAGGGGG + Intronic
904278151 1:29397469-29397491 GAGGGCCAGGCTGGCTCAGGTGG + Intergenic
904387081 1:30150247-30150269 GAGGGTGGGGCCAGGCGAGGTGG + Intergenic
904467698 1:30718192-30718214 GGGGGCGGGGCCACATCAGAGGG - Intronic
904782906 1:32964285-32964307 AGGCGCGGGGCCCGCTCAGGCGG + Exonic
904811242 1:33164699-33164721 CAGGGCTGGGCCACCTCTGGAGG + Intronic
905013228 1:34760768-34760790 CAGGGCTGGGCCAGGGCAGGAGG - Intronic
905221450 1:36450652-36450674 GAGGGCCGGGCCAGGGCTGGGGG + Intergenic
906165335 1:43681706-43681728 GATGGCGGGGGCAGGTCGGGGGG + Intronic
906477710 1:46181032-46181054 GAAGCCAGGGCCAGCCCAGGTGG + Intronic
906488184 1:46247536-46247558 GAGGGCGGGGCCAACAGAGGTGG - Intergenic
907548954 1:55287911-55287933 CTGGGTGGGGCCAGCTGAGGAGG + Intergenic
913186702 1:116374964-116374986 GAGGGCTGGTCCAGGTCAGGTGG + Intronic
914344867 1:146790302-146790324 GAGGGCGGGGCTATTTCAGGTGG + Intergenic
915280596 1:154819739-154819761 CAGGGCTGGGCCAGAGCAGGAGG + Intronic
915290218 1:154878518-154878540 CAGGGAGGGGCTGGCTCAGGGGG - Intergenic
916946914 1:169738319-169738341 GAGGGTGGGGGCAAATCAGGGGG + Intronic
917930425 1:179818880-179818902 GAGAGAGGGGCCAGCTGGGGAGG - Intergenic
918618708 1:186577861-186577883 GCTGGCGGTCCCAGCTCAGGTGG + Intergenic
919743140 1:200992451-200992473 CAGGGAGGGGCCAGCTCTGAGGG + Intronic
921471198 1:215552052-215552074 GAGGGCAGGGCCAGGTGTGGTGG - Intergenic
922119035 1:222644230-222644252 GAGGGCGGGGCCAGAGCGGACGG - Intronic
922195783 1:223359393-223359415 GAGGGAGGGTGCATCTCAGGTGG - Intronic
922499057 1:226083560-226083582 GTGGGCGTGGCGAGCTCCGGGGG - Intergenic
922863547 1:228839521-228839543 CAGGCCGGGGCCATCTAAGGTGG + Intergenic
923109465 1:230879609-230879631 GAGGGGGAGGCCAGCAGAGGAGG - Intergenic
923760187 1:236835253-236835275 GAAGATGGGGCCAGCTCAGAGGG + Intronic
1062835914 10:635624-635646 GAGGCCGTGGCCAGCCCTGGAGG + Intronic
1063214504 10:3912209-3912231 GCGAGAGAGGCCAGCTCAGGAGG - Intergenic
1063455261 10:6178451-6178473 GAGGGGGCTGCAAGCTCAGGCGG + Intronic
1063477421 10:6341035-6341057 GAGAGAGGGGACTGCTCAGGTGG + Intergenic
1067037844 10:42932842-42932864 GAGGGCGGGGCCTCCTGCGGAGG + Intergenic
1067669628 10:48306989-48307011 GAGGCGGGGGCCAGCCGAGGGGG + Intronic
1069571628 10:69497823-69497845 AAGGGCAGGGCCAGCTGAGCTGG + Intronic
1070662343 10:78316337-78316359 GAGGGCAGGGGCTGCTCTGGTGG + Intergenic
1071566819 10:86675352-86675374 GAGGCTGGGGCCAGATCAGAGGG - Intronic
1073053375 10:100683886-100683908 GAGGGAGGGGGCTGCCCAGGGGG - Intergenic
1073291460 10:102415199-102415221 GATGGGGGGGCCTGCTCTGGGGG + Exonic
1074615222 10:115060770-115060792 TAGGTCGGGGCCAGGTGAGGTGG - Intergenic
1074864097 10:117535048-117535070 GGGGGCGGGGGCAGCTGCGGGGG + Intergenic
1074869349 10:117564774-117564796 GAGCTCAGGGCAAGCTCAGGAGG + Intergenic
1074998490 10:118777956-118777978 AAGGGCTGGGCCATCTCCGGTGG - Intergenic
1075651128 10:124128849-124128871 GAGGGAGGGGTCAGCAGAGGGGG + Intergenic
1076130843 10:128012666-128012688 GAGGTGGGGGCTAGCTCTGGTGG + Intronic
1076293528 10:129366125-129366147 GAGGGTGGGGCCAGTGCAGGGGG + Intergenic
1076554309 10:131311851-131311873 GAGGGCGGGGCGGGGTCCGGCGG - Intergenic
1076569995 10:131426254-131426276 GAAGGAGGGGCCAGGGCAGGTGG + Intergenic
1076600984 10:131656812-131656834 GAGGGCCCGGCCGGATCAGGTGG + Intergenic
1076695298 10:132244448-132244470 GAGTGCAGGGCCAGCAGAGGCGG + Intronic
1076698619 10:132258752-132258774 GTGGCCTGGGCCCGCTCAGGAGG - Intronic
1076878687 10:133229861-133229883 GGGGGCGGGGGCAGCACTGGGGG + Intergenic
1077014390 11:393382-393404 GGGGGCGGGGCCGCCCCAGGGGG - Intronic
1077059247 11:610519-610541 GAGGGCTGGGCCGGGGCAGGCGG - Exonic
1077299194 11:1839394-1839416 GTGGGATGGGCCAGCGCAGGTGG - Intronic
1077320497 11:1938792-1938814 ATCCGCGGGGCCAGCTCAGGAGG + Intergenic
1077320506 11:1938827-1938849 ACGCGCAGGGCCAGCTCAGGAGG + Intergenic
1077450982 11:2645376-2645398 GAGGGTGGGACCAGGCCAGGTGG + Intronic
1080836536 11:35945038-35945060 AAGGGCGGGCCCAGTCCAGGAGG - Intronic
1080979964 11:37390331-37390353 GAGGGAAGGGCAAGGTCAGGTGG + Intergenic
1081611445 11:44565550-44565572 GGGGGCGGGGCCGGCGGAGGGGG + Intronic
1081810071 11:45909582-45909604 GAAGCCGGGGCCAGTTCAGGGGG - Intergenic
1081931752 11:46876415-46876437 GTGTGGGGGGCCAGCTCAGCTGG - Intronic
1083274322 11:61588136-61588158 GAGAGCTGGGCGAGTTCAGGTGG + Intergenic
1083306552 11:61764800-61764822 GGGGCCGGGGCCAGCGCAGAGGG + Intronic
1083728288 11:64639872-64639894 GAGGACCAGGCCAGCTCAGGAGG - Intronic
1083744904 11:64729991-64730013 GAGGGCGGGGCCGGGGCTGGAGG + Intronic
1083882117 11:65553888-65553910 GGGGGCGGGGCCTGCACTGGGGG + Exonic
1083952081 11:65962098-65962120 GGAGGCGGGGCCTGCGCAGGGGG + Intronic
1084503081 11:69546351-69546373 GAGGGAGGGGTCAGCCAAGGCGG + Intergenic
1085289843 11:75390113-75390135 AAGGGAGTGGGCAGCTCAGGTGG - Intergenic
1085392570 11:76189984-76190006 GAGGGCGGGGCCTCCTCATGAGG + Intronic
1085454667 11:76659091-76659113 GAGGGAGGGCCAAGCCCAGGAGG - Exonic
1087269094 11:96092858-96092880 GAATGCGGGGCCAGCTGATGGGG + Exonic
1088495689 11:110429844-110429866 TGGGGCGGGGCCAGCGCAGGGGG - Intergenic
1088883125 11:113987116-113987138 GAGGGCGTGGCCTGCCAAGGAGG + Intronic
1089500615 11:118929426-118929448 GAGGGCGGGGGCAGGGCGGGGGG + Intronic
1089966348 11:122656929-122656951 GAGGGCAGGGAGAGCGCAGGTGG + Intronic
1090207092 11:124891403-124891425 GAGAGCTGGGCCAGCTGGGGTGG + Exonic
1090242152 11:125191687-125191709 GTGGAGGTGGCCAGCTCAGGAGG + Intronic
1090377859 11:126304030-126304052 AGGGGCGGGGCCAGCGCAGGGGG + Exonic
1090919363 11:131194517-131194539 GCGGGGTGGGCCAGCTCAGAGGG - Intergenic
1091278933 11:134370967-134370989 GAGGGGTGGGCAGGCTCAGGAGG - Intronic
1091815228 12:3432573-3432595 GAGGGAGGAGACAGCTCAGGAGG + Intronic
1091853559 12:3720649-3720671 GAGGCTGGGACCAGGTCAGGAGG - Intronic
1092261481 12:6955504-6955526 CAGGGCTGGGGCAGCTGAGGTGG + Intronic
1096154266 12:49333039-49333061 CGGGGCGGGGCCGGCTCAGTCGG + Exonic
1096514522 12:52148642-52148664 GGGGGTGGGGCCAGCTCCTGGGG - Intergenic
1096674884 12:53221102-53221124 TGGGGCGGGGCCGGGTCAGGAGG - Intronic
1101376012 12:104172230-104172252 GGGGGCGGGGACAGGGCAGGCGG + Intergenic
1101589468 12:106113043-106113065 TGGGCCTGGGCCAGCTCAGGAGG + Intronic
1102461393 12:113101885-113101907 TGGGGCGGGACCAGCTCAGGTGG - Exonic
1102867500 12:116385768-116385790 GAGGGCGAGGCCAGGACATGAGG + Intergenic
1103325511 12:120117268-120117290 GGGGCCGGGGCCAGCTCCGCGGG - Intronic
1103763314 12:123266264-123266286 GACGGCGGCGCCAGGACAGGCGG - Intronic
1103939879 12:124495811-124495833 GGGACCAGGGCCAGCTCAGGCGG + Intronic
1104738874 12:131158027-131158049 GAGGGCGGGGCCAGCTTCATGGG + Intergenic
1104846901 12:131851425-131851447 CAGGGCTGGGCAGGCTCAGGTGG + Exonic
1104898340 12:132175166-132175188 CAGGGCTGGCCGAGCTCAGGAGG + Intergenic
1104926715 12:132317712-132317734 GAAGGTGGGGCCAGCTGGGGAGG - Intronic
1104988558 12:132611279-132611301 GAGGCCAGGGACAGCCCAGGGGG + Intergenic
1105068471 12:133219344-133219366 GGGGCTGGGGCCAGCTCTGGAGG + Exonic
1105243540 13:18628414-18628436 GGGGGCGGGGCCTGGACAGGTGG - Intergenic
1105514542 13:21077737-21077759 GAAGGCGGGGCCAGGTGCGGTGG - Intergenic
1105957989 13:25301828-25301850 GCCGGCGGGACCAGCACAGGCGG + Exonic
1107787609 13:43971061-43971083 GAGGCCGGGGCCAGACCAGCAGG + Intergenic
1112507862 13:99985596-99985618 GGGGGCGGCGGCAGCTCTGGCGG + Exonic
1113058519 13:106296156-106296178 GACTGCCGGGCCAGCTTAGGAGG - Intergenic
1114266568 14:21075695-21075717 GAGGGTGGGGGCTCCTCAGGAGG - Exonic
1114493815 14:23119174-23119196 GAGGGCAGGCCCAGGTCAGGAGG - Exonic
1115573975 14:34693343-34693365 GAGGGCGTGGCAGGCCCAGGTGG - Intergenic
1115851794 14:37595163-37595185 GCGGGCGGGGGCAGCGCCGGGGG + Intronic
1118819858 14:69338182-69338204 GAGGTTGGGGCCAGCCCAAGAGG + Intronic
1118940653 14:70333016-70333038 TAGGGCTGAGGCAGCTCAGGTGG + Intronic
1121456718 14:94043165-94043187 GAGGCCTGGGCCACCTCAGAAGG - Intronic
1121505148 14:94471705-94471727 CAGGGTGGGGGCAGCTCTGGAGG - Intronic
1122746181 14:103898471-103898493 GAGTGCAGGCACAGCTCAGGTGG + Intergenic
1122773634 14:104107821-104107843 GGGGGCGGGGCCAGCACTGGTGG + Intronic
1122787718 14:104171637-104171659 CAGGAGGGGCCCAGCTCAGGTGG - Intronic
1122873044 14:104650328-104650350 CAGGGCGGGGCGGGCTCACGCGG - Intergenic
1122920112 14:104876542-104876564 GAGGGAGGGGCCAGGGCTGGGGG - Intronic
1123017427 14:105382068-105382090 GAGGGCGTGGCACGCCCAGGAGG + Intronic
1123040222 14:105487350-105487372 GAGGCTGGGGACCGCTCAGGAGG + Intronic
1123487758 15:20756217-20756239 GGGGGCGGGGCCTGGACAGGTGG + Intergenic
1123544257 15:21325295-21325317 GGGGGCGGGGCCTGGACAGGTGG + Intergenic
1124640255 15:31392436-31392458 CAGGGCGGGGCCACATCAGGAGG - Intronic
1125371653 15:38984057-38984079 GAAGGGTGGGGCAGCTCAGGTGG + Intergenic
1125688595 15:41578597-41578619 GAGGGCAGGTCCAGCTCTGTGGG + Exonic
1125723121 15:41854549-41854571 GGGGACCGGGTCAGCTCAGGAGG + Intronic
1125748856 15:42015149-42015171 GAGTGCAGGGGCAGCTCGGGAGG - Intronic
1127656194 15:61058351-61058373 GCAGGCGGTGCCAGTTCAGGAGG + Intronic
1127829702 15:62739527-62739549 GATGGCTGGCCAAGCTCAGGTGG + Exonic
1128099896 15:64989930-64989952 GAGGGCGGGGCCACGTCGCGAGG + Exonic
1128318114 15:66673792-66673814 GAAGGCGGGGCTGGCGCAGGGGG - Intronic
1128344147 15:66842865-66842887 GGGCGCGGGGCCAGGTCGGGCGG + Intergenic
1128671505 15:69577580-69577602 GAGGGCGGGGGAAGCTTAGGAGG - Intergenic
1128738353 15:70066265-70066287 GGAGGCGTGGCCACCTCAGGAGG + Intronic
1128802882 15:70508241-70508263 GTGGGAGGGGCCAGATGAGGGGG - Intergenic
1129350798 15:74955080-74955102 GAGGCCAGGGCCAGCCCGGGAGG + Exonic
1129658105 15:77537921-77537943 GAGGGAGGAGCCAGGACAGGAGG + Intergenic
1129927651 15:79380116-79380138 GAGGGAGGGGCCGGATCACGAGG + Intronic
1131559649 15:93428358-93428380 GAGGGTGTGGCCAGCTAAGAGGG + Intergenic
1202952603 15_KI270727v1_random:52566-52588 GGGGGCGGGGCCTGGACAGGTGG + Intergenic
1132473561 16:120545-120567 GAGGGTCGTGCCAGTTCAGGAGG - Intronic
1132506828 16:314370-314392 CAGAGCGCGGCCAGCTCAGAGGG - Intronic
1132668072 16:1090933-1090955 CAGGGTGGGGCCAGCCGAGGAGG - Intronic
1132712214 16:1274090-1274112 GGTGGCGGGAGCAGCTCAGGAGG + Intergenic
1133029786 16:3004852-3004874 GCGGGAGGGGCCAGGTCAGCAGG - Intergenic
1133040260 16:3056906-3056928 GAGGCTGGGGCCACCTCTGGAGG + Intronic
1133279554 16:4657419-4657441 GGGGGTGGGGCCAGCACAGTGGG + Intronic
1133328685 16:4958060-4958082 GAGGGCGGGGCCAGTGAAGGGGG + Intronic
1133508945 16:6439519-6439541 GATGACTGGGGCAGCTCAGGAGG - Intronic
1135404909 16:22190832-22190854 GGGGGCGGGGCTAGGTCTGGAGG - Exonic
1136365956 16:29809433-29809455 GAGGACAGGGCCATCTGAGGAGG + Intronic
1136396121 16:29993495-29993517 GAGGGAGGAGGCAGCTGAGGTGG - Exonic
1136398864 16:30007077-30007099 GAGGGGGACGCCAGCTGAGGGGG + Exonic
1136475545 16:30510957-30510979 GTGGGCGGGGCCTGCTCACCAGG - Exonic
1136499178 16:30661227-30661249 CAGGGAGGGGCCAGGACAGGTGG - Intronic
1136535003 16:30894051-30894073 GAGGGCGCGGCCAACTCCAGGGG - Exonic
1137742964 16:50798879-50798901 GATGCCAGGGCCAGCTCTGGTGG + Exonic
1138646152 16:58426479-58426501 GAGGGGAGGGCCAGGTAAGGTGG + Intergenic
1138657608 16:58500160-58500182 GAGGGCGGGGGCAGCTCGAGTGG - Intronic
1139475931 16:67202554-67202576 GAGGCCTGGGCCAGGGCAGGGGG + Intronic
1139989125 16:70925003-70925025 GAGGGCGGGGCTATTTCAGGTGG - Intronic
1141513783 16:84529441-84529463 GTGGGCAAGACCAGCTCAGGAGG + Intronic
1141615377 16:85206912-85206934 GAGGGGTGGGCCAGCGCCGGTGG + Intergenic
1141683460 16:85556903-85556925 GGGGGCCGGGGAAGCTCAGGAGG + Intergenic
1141939451 16:87265123-87265145 GAAGGAGCGCCCAGCTCAGGTGG + Intronic
1142156276 16:88534125-88534147 GGGGGCGCGGCCGGCCCAGGGGG - Exonic
1142210372 16:88805695-88805717 GAGGATGGGGGCGGCTCAGGAGG - Intronic
1142469577 17:155880-155902 GAAGGCGGGGCCAGTGCCGGGGG - Intronic
1142498848 17:321242-321264 GGGGCCGGGGCCAGCTCAGTGGG - Intronic
1142743303 17:1942710-1942732 GAGCATGGGGGCAGCTCAGGCGG + Intronic
1142995021 17:3755073-3755095 GAGGGCGGGGCCACCTGATGAGG - Intronic
1142995028 17:3755092-3755114 GAGGGCGGGGCCACCTGATGAGG - Intronic
1143009865 17:3860144-3860166 GAGGGAAGGGCTGGCTCAGGAGG - Intergenic
1143165466 17:4895249-4895271 CAGGGCAGGGACAGCTGAGGAGG + Intronic
1143757239 17:9075953-9075975 GAGGGGTGGGCCAGCCCATGGGG - Intronic
1144792863 17:17871081-17871103 GAGGCCGGGGCCAGGTGTGGTGG + Intronic
1145903903 17:28506127-28506149 GGGGCCTGGGCTAGCTCAGGAGG + Intronic
1146488924 17:33265946-33265968 AGGAGTGGGGCCAGCTCAGGTGG - Intronic
1146650296 17:34602268-34602290 GCGGGCTGGGCCAGCCCAGGGGG - Intronic
1147156456 17:38546649-38546671 AAGGGCATGGCCAGCCCAGGAGG + Intronic
1147239384 17:39080583-39080605 GAGGGCAGGGCCAGCTGACATGG - Intronic
1148000531 17:44384816-44384838 GAGGGCGGGAGCGGCTTAGGCGG + Intronic
1148617906 17:49014143-49014165 AAGGGCGGCGGCAGCTGAGGCGG - Intronic
1148741732 17:49897091-49897113 GAGGGTGGGGCCAGCCCTGAGGG - Intergenic
1150134978 17:62690564-62690586 GAGGGCTGGAGCAGCTCTGGGGG + Intronic
1150423246 17:65056800-65056822 GAGGGCGGGCCCGGCCCCGGAGG + Exonic
1151716831 17:75835384-75835406 GGGGGCGTGGCCAGGGCAGGGGG - Intronic
1151885822 17:76922894-76922916 CAGTGTGGGGACAGCTCAGGAGG + Intronic
1152642086 17:81453596-81453618 CAGGGCAGGGGCAGCTCTGGGGG - Intronic
1152759360 17:82099853-82099875 GAGGGCTGGGCCAGCTACAGGGG + Intergenic
1153006272 18:500801-500823 GAGGGCGGGGCGGGCGCGGGAGG - Intergenic
1154445397 18:14431467-14431489 GGGGGCGGGGCCTGGACAGGTGG + Intergenic
1155355570 18:24950006-24950028 GAGGAAGGGGCCAGAACAGGAGG - Intergenic
1157451419 18:47792006-47792028 GTGAGCAGGGGCAGCTCAGGGGG - Intergenic
1158164138 18:54519931-54519953 GAGAGCAGAGCCAGCTAAGGAGG + Intergenic
1160027604 18:75231247-75231269 GCTGGCAGGGGCAGCTCAGGCGG + Intronic
1160060288 18:75523855-75523877 GAGGGCGAGGCCAGCAGAGTCGG - Intergenic
1160251210 18:77204869-77204891 GAAGGGGTGGCCAGCTCTGGCGG - Intergenic
1160522170 18:79513947-79513969 CAGTGAGCGGCCAGCTCAGGTGG - Intronic
1160596808 18:79981382-79981404 GAGTGCAGGGCCAGGTGAGGTGG + Intronic
1160736192 19:663374-663396 GGGGGCGGGGCCAAAGCAGGCGG + Intergenic
1160754016 19:748363-748385 GAAGGCGTGGCCAGGCCAGGGGG + Intergenic
1160785817 19:899892-899914 GAGGGCGGGGGCAACGAAGGCGG - Intronic
1160790655 19:921808-921830 AGGGGCGGGGCCAGCGCCGGCGG - Intergenic
1160797561 19:952978-953000 GTGGCCGGGGCCAGCACATGCGG - Intronic
1160906868 19:1455745-1455767 GTGGGCAGGGCCAGATCAGCAGG + Intronic
1161108415 19:2455772-2455794 GTGGGCAGGGCCTGCCCAGGTGG + Intronic
1161142136 19:2654150-2654172 GGGGGCGGGGCCGGCTGGGGAGG + Intronic
1161252080 19:3285772-3285794 GGGGGCGGGGCCAGGCCAGAGGG - Intronic
1161808921 19:6460358-6460380 GCGGGCGGGCTCAGCCCAGGAGG - Intronic
1162019627 19:7862712-7862734 GGAGGCGGGGCCGGATCAGGAGG - Intronic
1162019647 19:7862759-7862781 GCGGGCGGGGGCGGATCAGGAGG - Intronic
1162019658 19:7862789-7862811 GCGGGCGGGGGCGGGTCAGGAGG - Intronic
1162021470 19:7870266-7870288 GAGGGCGGGACCTGCAGAGGAGG + Exonic
1162021603 19:7870674-7870696 GAGGGAGGGGCCTGCAGAGGAGG + Exonic
1162021808 19:7871502-7871524 GAGGGCGGGGCCTGCATAGGGGG + Exonic
1162046669 19:8005150-8005172 GAGAGTGGGGCCAGCTACGGGGG - Intronic
1162109148 19:8390741-8390763 TAGGGCGGGGCCTCCGCAGGGGG + Intronic
1162144596 19:8605814-8605836 GAGGGGGGAGCCAGGTAAGGGGG + Intronic
1162717788 19:12644737-12644759 GAGGGCTGGGCCAGCTTGTGAGG - Intronic
1163002773 19:14379150-14379172 GAGGGCCAGACCAGCTCTGGAGG - Intergenic
1163012744 19:14435304-14435326 AAGAGCGGGGCCAGCTCAACTGG - Intronic
1163334325 19:16661115-16661137 GGGGGCGGGCCCAGCTGCGGGGG + Exonic
1163848862 19:19652400-19652422 GAGAGAGGAGCCAGCACAGGCGG + Intronic
1165395995 19:35563784-35563806 GAGGGGGGGGCCAGCCCAGGAGG - Intergenic
1167427062 19:49434737-49434759 GAGGGCAGGGTCATATCAGGCGG + Intronic
1167898539 19:52601233-52601255 GTGGGCGGGGCCTGGGCAGGCGG - Intronic
1168060616 19:53890029-53890051 GGGGGCGGGGCCAGGCGAGGGGG - Intronic
1168062357 19:53900003-53900025 GAAGGCGGGGCCAGAACACGTGG + Intronic
1168243297 19:55097824-55097846 TGGGGCAGGGTCAGCTCAGGGGG - Intronic
1168255146 19:55160976-55160998 GGGGGCGGGGCCTGCTGTGGGGG + Intronic
1168289861 19:55352391-55352413 TAGGGCTGGGTGAGCTCAGGGGG - Intronic
925025801 2:606213-606235 GTGGGCTGGGCCTGCTCATGTGG + Intergenic
925832584 2:7910615-7910637 GCTGGCAGGGCCAGCTCAGAGGG + Intergenic
926127274 2:10279317-10279339 GGAAGAGGGGCCAGCTCAGGAGG + Intergenic
926226485 2:10970823-10970845 GAGGGTGGGGCCAGCCTCGGAGG - Intergenic
926670106 2:15568940-15568962 GAGGGTGGGGCCAGGTGCGGTGG - Intergenic
926677977 2:15642490-15642512 GAGGGCTGGCTCAGCTCAGAGGG + Intergenic
927112365 2:19872635-19872657 GAGAGTGGGGACAGATCAGGAGG + Intergenic
929555832 2:42925093-42925115 GAGTGCGGGGATATCTCAGGAGG - Intergenic
930091414 2:47534043-47534065 GGAGGCGGGGACAGCTGAGGTGG + Intronic
932753925 2:74391853-74391875 GAGGGCGGGGCCGGCCCCGCAGG - Intronic
935293680 2:101630289-101630311 GAGGCAGGTGCCAGATCAGGAGG - Intergenic
937153649 2:119703043-119703065 CAGGGCGTGGCCGGCTCAGCAGG + Intergenic
937991530 2:127664781-127664803 GAGGGCAGAGTCAGCTGAGGAGG + Intronic
938252601 2:129827461-129827483 GCGGGCGGGGCCGGCTGAAGGGG + Intergenic
938440122 2:131322496-131322518 GCAAGCGGGGCCAGCTTAGGGGG - Intronic
938500782 2:131830498-131830520 GACCGCGGGGCCGGCTCGGGCGG + Intergenic
942299279 2:174546785-174546807 GAGGGCGGGCCCAGCTCTCTTGG + Intergenic
942306324 2:174610881-174610903 GAGTGTGGGGCCAGATCTGGGGG - Intronic
944422896 2:199549715-199549737 GAGGGTGTGGCCAGAGCAGGAGG - Intergenic
947567555 2:231204293-231204315 GGGGCCGGGGCCAGGTCAGGTGG - Intronic
947996851 2:234535051-234535073 CAGGGTGGGGCCAGCTAATGAGG + Intergenic
948210658 2:236190988-236191010 GAAGGTGGGGGCAGATCAGGAGG - Intergenic
948812946 2:240494255-240494277 GAGGGTGGGGCCAACTTTGGTGG + Intronic
948824201 2:240566544-240566566 GGGGGCGGGGCCTCCTCGGGCGG + Intronic
948831609 2:240601081-240601103 AAGGGCCTGGCCAGCCCAGGTGG - Intronic
948893118 2:240916529-240916551 GAGCGCGGGGGGAGCGCAGGGGG - Intergenic
1169123473 20:3111038-3111060 GAGGGCCAGGGCAGCACAGGAGG - Intronic
1171810471 20:29742142-29742164 GAGGGCGGGGGCGGATGAGGAGG + Intergenic
1171852197 20:30316688-30316710 GCGGGCCGGGCCAGGCCAGGCGG - Intergenic
1173088728 20:39950167-39950189 GAGGGGGGGGGCAGATCATGAGG + Intergenic
1173353432 20:42265535-42265557 GAGAGAGGGGGCAGCTCTGGGGG - Intronic
1173463314 20:43261398-43261420 CAGGGCTGGGGCAGCTCTGGGGG - Intergenic
1173554306 20:43954631-43954653 CAGGCAGGGGCCAGCTGAGGAGG + Intronic
1173821477 20:46022686-46022708 TTGGGAGGAGCCAGCTCAGGCGG + Intronic
1175036073 20:56003342-56003364 GAGGGCGGGGGCAGAGCCGGGGG - Intronic
1175278652 20:57788275-57788297 GAGGGTGGGGTCTGCTCGGGGGG - Intergenic
1175743368 20:61436109-61436131 GAGGGCAGGGCCAGCTCCACTGG - Intronic
1175757209 20:61537438-61537460 GAGGCCCAGGCCAGCTCGGGAGG + Intronic
1175873768 20:62220125-62220147 GGGGCCGGGGCCAGAGCAGGCGG + Exonic
1175919011 20:62441333-62441355 AAGGTCGGGGTCAGCTCAGAGGG + Intergenic
1175946075 20:62559355-62559377 GAGGGCCGGGACAGGTGAGGAGG - Intronic
1176023254 20:62973212-62973234 GCGGGCGGTGCCAGCTCTGGTGG + Intergenic
1176450582 21:6858392-6858414 GGGGGCGGGGCCTGGACAGGTGG - Intergenic
1176828752 21:13723410-13723432 GGGGGCGGGGCCTGGACAGGTGG - Intergenic
1179544991 21:42107810-42107832 CTGGGTGGGGCCAGCTCAGGAGG + Intronic
1179789805 21:43749772-43749794 GAGGGTGGGGGCAGCACAGGCGG + Intronic
1179955257 21:44734893-44734915 GAGGACGGGGCCGGGGCAGGCGG - Intergenic
1180148983 21:45938047-45938069 GAGGGCGGGGTGAGAGCAGGAGG + Intronic
1180800048 22:18627430-18627452 GGGGGCGGGGCCAGCTCTAGGGG + Intergenic
1180901262 22:19374966-19374988 GAGGGAGGGGCCCTCTCAGGAGG + Intronic
1180915106 22:19480238-19480260 GAGGGCGGGGCCGGCGCGCGAGG + Intronic
1181031052 22:20149078-20149100 GAGGGCAGGTCCAGGGCAGGGGG - Intronic
1181221667 22:21367836-21367858 GGGGGCGGGGCCAGCTCTAGGGG - Intergenic
1181313338 22:21957183-21957205 GAGGGCGGGGCCGGGCCAGGAGG - Exonic
1181346443 22:22223255-22223277 GAGGGCGGGGCCGGGCCAGGAGG - Intergenic
1181635511 22:24172544-24172566 GAGGGCAGGGGCAGGTCAGGGGG + Intronic
1181637563 22:24181430-24181452 GCGGGCGGGGCCAGGCCAGCAGG + Exonic
1181638330 22:24184485-24184507 GTGGGAGGGGGCAGCTCATGGGG + Intronic
1182122798 22:27798211-27798233 GGGGGCGGTGGCAGCTCTGGTGG - Exonic
1182123659 22:27801623-27801645 GGGCGCGGGGGCAGCTCTGGGGG + Intergenic
1182125142 22:27810673-27810695 GAGGGTGGGGCCTGCACAGCTGG - Intergenic
1182362141 22:29752949-29752971 CAGGGAGGGGCCTGCCCAGGTGG - Intronic
1182380371 22:29883050-29883072 GGGGGCGGGGCCTGGACAGGTGG - Intergenic
1182681731 22:32084747-32084769 CAGGGAGGGGAGAGCTCAGGTGG + Intronic
1182713141 22:32335012-32335034 GAGAGCGGGGCCAGCTCGCATGG + Intergenic
1182727519 22:32459909-32459931 GAGGGAGGGGTCAGGCCAGGTGG + Intronic
1182843913 22:33415187-33415209 CAGGGGAGGCCCAGCTCAGGTGG + Intronic
1183248662 22:36712808-36712830 GGAGGCGGGGCCTGGTCAGGGGG + Intergenic
1183311465 22:37112158-37112180 CAGGGCTGGGCCAGGGCAGGAGG + Intergenic
1183831214 22:40419171-40419193 GAGCACGGGGCCAGCCCTGGTGG - Exonic
1184565482 22:45289188-45289210 GAAGGCGGGGCCAGCCACGGCGG + Intronic
1184861106 22:47173728-47173750 GAGGGTGGGGCCACCTCACAAGG - Exonic
1184879719 22:47297224-47297246 GGGGGCGGGGCACCCTCAGGAGG - Intergenic
1185015206 22:48338894-48338916 GAGGCCGGGCCCTGCTCAGGGGG - Intergenic
1185050141 22:48550155-48550177 CAGGGCAGGGCCACCTCGGGTGG - Intronic
1185171692 22:49298083-49298105 GTGGGAGGGGCCAGGTCAGAGGG + Intergenic
1185241578 22:49750149-49750171 GGGGTCGGGGCCTGCTCTGGAGG - Intergenic
1185313519 22:50169582-50169604 GGGGCCTGTGCCAGCTCAGGGGG - Intergenic
1185381033 22:50507690-50507712 GAGGGCGGGCCCTGCTCTAGCGG - Exonic
1185382597 22:50516993-50517015 CAGGGCAGGGCCAGGACAGGAGG + Intronic
1185410459 22:50678927-50678949 GAGGGCGGGGCCTGGCCTGGAGG + Intergenic
950084617 3:10248637-10248659 GAGGGCGCTGCCAGCTCCCGAGG + Exonic
950395702 3:12732311-12732333 GAGGCCGGGGCCAGGTGTGGTGG - Intergenic
950646798 3:14382163-14382185 GAGGGTGGGGCCAGATCTGAAGG + Intergenic
953769260 3:45766107-45766129 GAGGGCGGGGCCAGGGCAGCAGG + Intronic
954617195 3:51975165-51975187 GCGGGCGGGCCCCGCCCAGGCGG - Exonic
954750576 3:52811210-52811232 GGGGACCGGGCCAGCACAGGTGG - Intergenic
955239364 3:57165441-57165463 GGGGGCGGGGCCAGCACACGAGG - Intronic
959622752 3:108415840-108415862 GAGGCTGGAGCCAGATCAGGGGG + Intronic
961453000 3:127010879-127010901 GATGGTGGGGGCAGCTCAGCTGG + Intronic
961512476 3:127411525-127411547 GAGGGTGGGGCCAGCTGCAGAGG - Intergenic
962334153 3:134510902-134510924 GAGGGAAGAGCCATCTCAGGAGG + Intronic
962346111 3:134620078-134620100 GTGGGCAGGGCCAGATCACGAGG - Intronic
962746365 3:138400046-138400068 GAGGTGGGGGCCAGCTCCGACGG + Intronic
963252996 3:143119669-143119691 GGGGGCGGGGCCGGCGAAGGGGG + Exonic
966816722 3:183895923-183895945 CAGGGCTGGGGCTGCTCAGGCGG + Intergenic
968232618 3:197012567-197012589 GTAGGTGGGGCCTGCTCAGGGGG - Intronic
968640617 4:1712637-1712659 GCGGGCGGGGGCAGCTTTGGCGG + Intergenic
968733970 4:2285747-2285769 GAGGGCTGGGCCGGTCCAGGAGG + Intronic
969348635 4:6585035-6585057 GAGGGTGGGGGGAGCACAGGGGG - Intronic
969365189 4:6690110-6690132 GAGGGCGGGGCCTGTGCTGGGGG - Intergenic
973684395 4:53354478-53354500 GAGGCCGGAGCCAGCTCACTTGG - Intronic
977686078 4:99848862-99848884 GAGGGCCGGGCCAGGTCTGGAGG + Intronic
977723800 4:100270794-100270816 CAGGGCTGGGCTACCTCAGGAGG + Intergenic
979064301 4:116108788-116108810 GTGAGCGGGGCCAGCTTATGGGG - Intergenic
982268539 4:153563555-153563577 GAGGACGGGTCGAGCTCAGGAGG - Intronic
984167595 4:176320571-176320593 GCGGGAGGCGCCAGCCCAGGCGG - Intronic
984883331 4:184429222-184429244 GAGGGCTGGGCTTGCACAGGTGG - Intronic
985537438 5:473152-473174 GGGGGCGGGGCCTGCGCCGGGGG - Intergenic
985707731 5:1411172-1411194 GAGGGCAGGGCCCCCTCGGGTGG + Intronic
985714245 5:1446542-1446564 GAGTGCGGGGCGGGCGCAGGGGG - Intergenic
986466937 5:8035036-8035058 GAGGGCGGGGCCAGAGAGGGCGG + Intergenic
990545204 5:56815507-56815529 GGGGGCGGGGAGAGCGCAGGGGG - Intergenic
994072973 5:95621457-95621479 GAGGGTGGGGCCAGCGTTGGCGG - Exonic
998158584 5:139800095-139800117 CAGGGCTAGGCCAGCTCAGATGG + Intronic
998252402 5:140561918-140561940 GAGGGTGGGCCCAGCTCAGCAGG - Intronic
1002064941 5:176647334-176647356 GGGGGCGGAGCCAGGTCAGGAGG + Intergenic
1002712642 5:181204528-181204550 GAGCGCGGGACCAAGTCAGGGGG + Intronic
1002817445 6:693549-693571 GAGGGCTGCACCAGGTCAGGGGG + Intergenic
1003116059 6:3284588-3284610 GAGGGCTGGGGCAGGCCAGGCGG + Intronic
1005928923 6:30466380-30466402 GAGGCCCGGGCGAGCTCGGGCGG + Intergenic
1006337359 6:33427742-33427764 GTGGGGGGGTCCTGCTCAGGAGG + Intronic
1006365233 6:33611256-33611278 GAGGCCAGGCCCAGCCCAGGTGG + Intergenic
1006510040 6:34516647-34516669 GAGGTCGGGGCCAGGCCTGGAGG - Intronic
1006579997 6:35071685-35071707 GAGCGTGTGGCCAGCTCAGGGGG - Intronic
1007386462 6:41523427-41523449 CAGGGCGTGGCCAGCTCAGGTGG - Intergenic
1007586709 6:42995057-42995079 AAGAGTGGGGCCAGCTCAGAGGG - Intronic
1007664501 6:43506374-43506396 GAGGGAGGAGACAGCTGAGGGGG - Exonic
1007690743 6:43699597-43699619 GAGGGAGAGGCCAGGACAGGGGG + Intergenic
1007813047 6:44499805-44499827 TAGGGAGGGGCCAACTCAGGTGG + Intergenic
1008539165 6:52531616-52531638 GAGGGCGCAGACACCTCAGGGGG - Intronic
1009526280 6:64750896-64750918 GAAGGGAGGGGCAGCTCAGGGGG - Intronic
1013022842 6:106235999-106236021 AAGGTCTGGGCCAGGTCAGGAGG - Intronic
1017174734 6:151492626-151492648 TAAGGCGGGGCCAGGTGAGGTGG - Intergenic
1017651135 6:156583587-156583609 GAGGGGAGGGAAAGCTCAGGTGG - Intergenic
1018165059 6:161085802-161085824 GAGAGCGGTTCCAGTTCAGGGGG + Intronic
1018988653 6:168656929-168656951 GATGGCCGGGCCAGCACAGGGGG - Intronic
1019427606 7:984794-984816 GGGGCCAGGGCCAGCCCAGGGGG + Intronic
1019735211 7:2647046-2647068 GAGGGCGGGGCCAGAGGGGGCGG + Intronic
1021639888 7:22727077-22727099 GAGGGTGGGGCCAGAGCGGGTGG - Intronic
1021877186 7:25059919-25059941 GGGGGCGGGGACAGCACAGCAGG - Intergenic
1021936789 7:25639072-25639094 GAGGGCGTGGGCAGCTGGGGAGG + Intergenic
1021941298 7:25681233-25681255 CAGGGCTTGCCCAGCTCAGGCGG - Intergenic
1022109684 7:27220650-27220672 GAGGACGCGGCCAGGTCGGGAGG - Intergenic
1022293129 7:29022742-29022764 GAGGGTGGGGCCAGGTGAGCTGG - Intronic
1023360965 7:39414675-39414697 GAGGGCGGGGCGACCTTGGGCGG - Intronic
1026479081 7:70763253-70763275 GAGGGGTGGGCCTGCACAGGTGG - Exonic
1029537858 7:101166475-101166497 GAGGGCGAGACCAGAGCAGGTGG + Intergenic
1029548356 7:101223083-101223105 GAGGGCAGGGCCAGGTGTGGTGG + Intronic
1029604682 7:101591276-101591298 CAGGGCTGGGCCACCTGAGGAGG - Intergenic
1031359662 7:120833791-120833813 GAAAGCAGTGCCAGCTCAGGGGG - Intronic
1032134425 7:129262579-129262601 GAGGGAGGGGCAATGTCAGGAGG + Intronic
1032349768 7:131150036-131150058 AAAGACGGGGCCAGCTGAGGTGG - Intronic
1033288738 7:140063248-140063270 GAGGGCGGCGGCAGCGCTGGCGG + Exonic
1033662064 7:143408894-143408916 GGGGGCGGGGCCAGCGCCGGGGG + Intergenic
1034262303 7:149764727-149764749 GGGGGCGGCGCCACCTCGGGGGG + Exonic
1035412413 7:158655712-158655734 GAGGACGGGGCCTGGTCATGAGG - Intronic
1035595436 8:853924-853946 GAGGGTGGGGCCGCCACAGGTGG + Intergenic
1037815351 8:22109082-22109104 GAGCGCGCAGCCAGCCCAGGTGG - Intronic
1037828907 8:22176935-22176957 GAGGGCGGGGCCAGCTCAGGGGG - Intronic
1040080040 8:43275994-43276016 GCAGCCGGGGCCAGCTCTGGAGG + Intergenic
1041570578 8:59333264-59333286 GAGGGTGGGGGCAGCACAGTGGG - Intergenic
1045099021 8:98826115-98826137 GAGCTCTGGGCCAGCTCAGAGGG - Intronic
1045323714 8:101101353-101101375 GGGGAGGGGGCCAGGTCAGGTGG - Intergenic
1045368005 8:101493869-101493891 GAGGGCGGGGGCCGGCCAGGGGG - Intronic
1045479248 8:102579241-102579263 GAGTGCGGGGCCACCGCAGTAGG + Intergenic
1047208428 8:122821325-122821347 GGGGGCTGGGCCAGCTCCGTGGG + Intronic
1049202981 8:141350874-141350896 GAGGGCCGGGGCAGCAGAGGAGG + Intergenic
1049220923 8:141428418-141428440 GATGGCAGGGCCAACTCTGGAGG + Intronic
1049429109 8:142550980-142551002 GAGGGAGGGGACAGGTCTGGAGG + Intergenic
1049453633 8:142676064-142676086 GAGGCCGGGGCCAGGACAGCCGG - Intronic
1049488409 8:142878428-142878450 GAGGGTGGCGCCTGGTCAGGTGG - Intronic
1049493304 8:142916448-142916470 GAGGGTGGCGCCTGGTCAGGTGG - Intronic
1049537407 8:143188771-143188793 GAGGGCAGGGCCGGCTGGGGAGG + Intergenic
1049557307 8:143289469-143289491 GAGGGCGGGGCCGAGGCAGGAGG + Intergenic
1049664535 8:143837100-143837122 GGGGGTGGGGCCAGCACACGGGG + Exonic
1050018457 9:1260114-1260136 CAGGGCTGGGCCTGCTCAGCAGG - Intergenic
1053114659 9:35490302-35490324 GAGGGCGGGTGCAGCCGAGGGGG - Intronic
1053422139 9:37986401-37986423 GAAGGTGGGGCCAGCTATGGAGG + Intronic
1053930317 9:43110162-43110184 GAGGCAGAGGCCAGCTGAGGGGG + Intergenic
1057039931 9:91840580-91840602 GGGAGCATGGCCAGCTCAGGAGG - Intronic
1057133233 9:92669481-92669503 GAGGGCCCGGCCAGCACTGGAGG - Intronic
1057452312 9:95175712-95175734 GAGGGTGGGGCCTGCACAGCAGG + Intronic
1057519901 9:95752221-95752243 GAGAGTGGCGCCAGCGCAGGAGG + Intergenic
1059479299 9:114576018-114576040 TAGGCAGGGGCCAGCTCAGTGGG - Intergenic
1059520196 9:114933663-114933685 GAGGGCCGGGCAAGCAGAGGGGG - Intergenic
1060658141 9:125387008-125387030 GAGGTGGAGGCCACCTCAGGAGG + Intergenic
1061089745 9:128420263-128420285 GAGGACGCGCCCAGCTCAGGGGG + Intronic
1061307941 9:129743188-129743210 GAGGGCTGGGCCAGCCCCAGGGG - Intronic
1061319216 9:129817327-129817349 GATGCCGTGGGCAGCTCAGGGGG - Intronic
1062003566 9:134228596-134228618 GAAGGCGGGCCTTGCTCAGGCGG - Intergenic
1062358829 9:136177920-136177942 GCGGGCGGGGACAGCACTGGGGG + Intergenic
1062358842 9:136177965-136177987 GCGGGCGGGGACAGCACTGGGGG + Intergenic
1062358854 9:136178010-136178032 GAGAGCGGGGACAGCACTGGGGG + Intergenic
1062423955 9:136497568-136497590 GAGGGCGGGGGCCGGTGAGGGGG + Intronic
1062498889 9:136844015-136844037 GACGGCGGGGTCGGCTCGGGTGG - Intronic
1062507749 9:136886688-136886710 GGGGGCGGGGCCAGCCCGAGGGG + Intronic
1062526021 9:136978447-136978469 AGGGGCGGGGCCATCTCCGGGGG + Intronic
1062526100 9:136978652-136978674 AAGGGCGGGGCCAGCTCTTGGGG + Intronic
1062542451 9:137047655-137047677 GAGGGCAGGCCCACATCAGGAGG - Intergenic
1062614427 9:137389566-137389588 AAGGGCGGTACCAGCTCAGGGGG + Intronic
1203518600 Un_GL000213v1:26125-26147 GGGGGCGGGGCCTGGACAGGTGG + Intergenic
1203364701 Un_KI270442v1:247592-247614 GAAGGTGGGGCCAGATCAGCTGG - Intergenic
1185464282 X:345883-345905 GGGGGTGGGGGCAGCTCTGGGGG + Intronic
1185525418 X:774728-774750 GAGGACGTGGCCAACCCAGGGGG + Intergenic
1185611246 X:1394820-1394842 GAGGTTGGGGCCAGCTCTGGAGG + Intergenic
1185729418 X:2449299-2449321 GAGGGCCGGGCCTGCTCAGGAGG + Intronic
1185730813 X:2460226-2460248 GAGGGCCGGGCCTGCTCAGGAGG + Intronic
1185733758 X:2481773-2481795 GAGGGCTGGGCCTGCTCAGGAGG + Intronic
1185751552 X:2614276-2614298 GAAGGCTGGGCCAGGTAAGGTGG + Intergenic
1188149061 X:26649858-26649880 GAGGGGGGGGGCAGATCACGAGG + Intergenic
1189472192 X:41322910-41322932 GAGGCCAGGGCATGCTCAGGGGG + Intergenic
1190717389 X:53115430-53115452 CAGGGCCAGGCCAGCCCAGGTGG - Intergenic
1190739877 X:53281623-53281645 GAAGGCGGGGCCAGGCCAGCTGG + Intronic
1191085533 X:56563760-56563782 GCGGGCTGGGCCGGGTCAGGCGG - Exonic
1192634716 X:72806286-72806308 GAGTTAGGGCCCAGCTCAGGAGG + Intronic
1192646997 X:72914515-72914537 GAGTTAGGGCCCAGCTCAGGAGG - Intronic
1195082713 X:101386312-101386334 AAGGGCGGGGACAGTTGAGGGGG - Intronic
1196717560 X:118825394-118825416 GAGGGTGGTGCCAGCCCAAGGGG + Exonic
1196842112 X:119868537-119868559 GAGTTCGAGACCAGCTCAGGAGG + Intergenic
1199844111 X:151678530-151678552 AAGGGCGAGGCCAGGCCAGGTGG - Intergenic
1199863601 X:151823318-151823340 GAAGGAGGGGCCAACTGAGGAGG + Intergenic
1200057798 X:153470698-153470720 GAGCCCGGGGCCCGCGCAGGCGG - Intronic
1200110423 X:153738036-153738058 GAGGAGGGGGCCGGCACAGGTGG + Intronic
1200398384 X:156004416-156004438 GAGGGCGGGTCCAGCTTAACTGG - Exonic