ID: 1037828908

View in Genome Browser
Species Human (GRCh38)
Location 8:22176936-22176958
Sequence GGAGGGCGGGGCCAGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 480}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828908_1037828923 10 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828908_1037828921 9 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828908_1037828924 11 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1037828908_1037828925 12 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828908_1037828918 -3 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828918 8:22176956-22176978 TCCAGGTGCTGCTCCTACGTGGG 0: 1
1: 0
2: 1
3: 12
4: 102
1037828908_1037828920 6 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828920 8:22176965-22176987 TGCTCCTACGTGGGTCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 33
1037828908_1037828917 -4 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828917 8:22176955-22176977 CTCCAGGTGCTGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 20
4: 151
1037828908_1037828926 20 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828926 8:22176979-22177001 TCGCCGCGGCGGGGGCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828908 Original CRISPR GGAGGGCGGGGCCAGCTCAG GGG (reversed) Intronic
900212476 1:1462901-1462923 GAAGGGTGGGGCCATGTCAGTGG + Intronic
900298829 1:1966433-1966455 GGACCCCGGGGCCAGCTCAGAGG - Exonic
900316508 1:2059855-2059877 GGAGGGAGGGGCCAGGTGGGAGG + Intronic
900353729 1:2249656-2249678 GGAGGGAAGAGCCAGCACAGAGG + Intronic
900986061 1:6073317-6073339 GGAGGGCGGTGTCAGGGCAGTGG - Intronic
901078918 1:6572696-6572718 GGAGGGCGAAGCCTGCTCCGGGG - Intronic
901235445 1:7665055-7665077 GGAGGGCGGGGCCAGCACCATGG + Exonic
902849064 1:19139107-19139129 GGAGAGCGGGGGCAGTGCAGTGG - Exonic
903132627 1:21289851-21289873 GGATGGCGGGGGCAGGTGAGGGG + Intronic
903500872 1:23799672-23799694 GCAGGCTGAGGCCAGCTCAGGGG + Intronic
903554758 1:24185504-24185526 GGAGGGAGGGTCCAGTTCTGTGG + Intronic
903559334 1:24216188-24216210 GGAGGGAGGGGACGGCTGAGCGG + Intergenic
903840223 1:26233828-26233850 GGAGGGTGAGGCAAGCTGAGTGG + Intergenic
903999159 1:27328649-27328671 AGGGGGAGAGGCCAGCTCAGGGG - Intronic
904353117 1:29921874-29921896 GGAAGGCAGGACCAGCGCAGGGG - Intergenic
904467699 1:30718193-30718215 GGGGGGCGGGGCCACATCAGAGG - Intronic
904467749 1:30718402-30718424 AGGGGGCGGGGCCAGGGCAGGGG - Intronic
904476839 1:30770481-30770503 GGCGGGAGAGGCCAGGTCAGGGG + Intergenic
905106357 1:35565734-35565756 GGAGGGGGGGGCCAGATTGGGGG - Exonic
905123036 1:35696326-35696348 TGAGGGCCGAGCCAGGTCAGTGG - Intergenic
906125881 1:43426666-43426688 AGAGGGCAGGGCCAGCAGAGAGG - Intronic
906299892 1:44674230-44674252 GGAGGGCGGGGCCGCATGAGGGG + Intronic
908388868 1:63667565-63667587 GGAGAGCTGGGCCAGGACAGTGG - Intergenic
908414944 1:63904074-63904096 GGGAAGCGGGGCCAGGTCAGGGG + Intronic
908445603 1:64196619-64196641 GCTGGGCAGGGCCAGCTGAGGGG + Intergenic
909094559 1:71271113-71271135 GGAGGGTGGGGCCCTCTCTGGGG + Intergenic
910521527 1:88127327-88127349 GGAGATCAGGGCCAGTTCAGAGG - Intergenic
911058942 1:93731485-93731507 GGAGGGCGGAGCAGGCCCAGCGG - Intronic
911871776 1:103108372-103108394 GGCCGGTGGGGCCAACTCAGAGG - Exonic
912559280 1:110538588-110538610 GGAGGCCTGGGCCTGCTGAGAGG - Intergenic
912977884 1:114346323-114346345 GGAGGGCCGGGCCAGCCCAGGGG + Intergenic
915279712 1:154814088-154814110 GGTGGGCATGGCCAGCTCACTGG + Intronic
917964838 1:180171947-180171969 GGAGGGCGGGGAGAGATCACTGG + Intronic
919588232 1:199465568-199465590 GGAGGGCAGGACAAGGTCAGAGG + Intergenic
919743139 1:200992450-200992472 CCAGGGAGGGGCCAGCTCTGAGG + Intronic
919798723 1:201337686-201337708 GGAGGGAGGGCCCAGCTGTGTGG + Intergenic
919888331 1:201951447-201951469 GGAGTGCTGGGCCAGGCCAGTGG - Intergenic
920417423 1:205808241-205808263 GGAGAGGGGGCCGAGCTCAGTGG - Intronic
920672928 1:208018288-208018310 AGAGGGCAGGGCCAGCCCACAGG - Intergenic
920957261 1:210630875-210630897 GAGGCGGGGGGCCAGCTCAGAGG + Intronic
921356546 1:214289786-214289808 GGAGGAAGGGGCCAGTGCAGGGG - Intronic
922116382 1:222618052-222618074 GGAGGCCGGGGCGGGCGCAGAGG - Intergenic
922499058 1:226083561-226083583 GGTGGGCGTGGCGAGCTCCGGGG - Intergenic
922589825 1:226766426-226766448 GGAGGGCAGGGAAGGCTCAGAGG - Intergenic
922778165 1:228227078-228227100 GGAGGGCAGGGCCAGCTTGGTGG + Intronic
922892771 1:229074302-229074324 GGAGGGCAGAGGGAGCTCAGAGG + Intergenic
922899211 1:229123281-229123303 GAAGGTCCGGGCCAGCTCAGGGG - Intergenic
923109434 1:230879528-230879550 GGAGGGGGAGGCCAGCAGAGGGG - Intergenic
923760186 1:236835252-236835274 AGAAGATGGGGCCAGCTCAGAGG + Intronic
1062875578 10:940529-940551 GGAGGGGGGCGCCTGCCCAGAGG + Intergenic
1067463272 10:46474129-46474151 GGAGGGCAGGGCCAGCTGTTTGG - Intergenic
1067623922 10:47910509-47910531 GGAGGGCAGGGCCAGCTGTTTGG + Intergenic
1067669627 10:48306988-48307010 GGAGGCGGGGGCCAGCCGAGGGG + Intronic
1069557262 10:69406568-69406590 GGGGGCTGGGGCCAGCACAGGGG - Intronic
1069602434 10:69716709-69716731 GAGGGACGGTGCCAGCTCAGTGG - Intergenic
1069905937 10:71732125-71732147 GAAGGGCGGGGCCTGGTCAGTGG - Intronic
1070795078 10:79211644-79211666 GGATGGCAGGGCCAGGTCTGGGG - Intronic
1070827928 10:79401915-79401937 GGAGCCCAGGGCCACCTCAGCGG - Intronic
1071468359 10:85961257-85961279 GGAGGCAGGGGCAGGCTCAGAGG - Intronic
1071526406 10:86362272-86362294 GGAGGGCAGGGCCTTCTTAGCGG - Intronic
1071566820 10:86675353-86675375 AGAGGCTGGGGCCAGATCAGAGG - Intronic
1072413858 10:95230890-95230912 GGAGGGAGGGACCAGAGCAGAGG + Intergenic
1072718394 10:97766418-97766440 GGAGGTCAGGGCCTGATCAGAGG - Intergenic
1073053376 10:100683887-100683909 GGAGGGAGGGGGCTGCCCAGGGG - Intergenic
1073590472 10:104752532-104752554 TGTGGGCTGGGCCAGCTCAGAGG + Intronic
1074164258 10:110860873-110860895 GGAGGGCAGGAACAGCTCTGGGG + Intergenic
1075412686 10:122240619-122240641 GCTGGGAGGGGCAAGCTCAGCGG + Intronic
1075651127 10:124128848-124128870 GGAGGGAGGGGTCAGCAGAGGGG + Intergenic
1076142630 10:128091818-128091840 GGGGGGCCGGGGTAGCTCAGCGG + Intergenic
1076293527 10:129366124-129366146 GGAGGGTGGGGCCAGTGCAGGGG + Intergenic
1076626094 10:131822888-131822910 GGAGGGGGCGGCCAGCAGAGTGG + Intergenic
1076685950 10:132198581-132198603 TGAGGTCGGGGCGAGCACAGTGG - Intronic
1076904873 10:133356741-133356763 AGAGGGAGGGGTCAGCTCTGGGG + Intronic
1077014391 11:393383-393405 GGGGGGCGGGGCCGCCCCAGGGG - Intronic
1077076118 11:702997-703019 GGAGGGCGGTGCCAGCCGTGAGG - Exonic
1077273224 11:1691561-1691583 GGGGTGCGGGGCCAGCTGTGAGG - Intergenic
1077508676 11:2943897-2943919 GCAGGGCGGGGCCAGCCACGTGG + Intergenic
1080577068 11:33609612-33609634 GGTGGGCCTGGCTAGCTCAGAGG + Intronic
1080642579 11:34166346-34166368 GGAGGCGGGGGCCTGCTCACTGG + Intronic
1080746910 11:35116378-35116400 GGAGTGCGGGGGCAGCTCTGTGG + Intergenic
1081810072 11:45909583-45909605 GGAAGCCGGGGCCAGTTCAGGGG - Intergenic
1083162544 11:60863863-60863885 GAAGGGCGGTCCCAGATCAGAGG + Intergenic
1083184116 11:61007722-61007744 GGTCGGCGGGGCGAGCTGAGAGG - Exonic
1083306551 11:61764799-61764821 TGGGGCCGGGGCCAGCGCAGAGG + Intronic
1083329621 11:61891482-61891504 GCAGGGCGGGGCCGGAGCAGCGG - Exonic
1083679060 11:64342948-64342970 GAAGGGCGGGGCCTGCACAAAGG + Intronic
1083811598 11:65109649-65109671 GTATGGTGGGGGCAGCTCAGGGG - Intronic
1083852290 11:65375457-65375479 GGAGAGCGGGGCCAGCCCCGGGG + Exonic
1083880077 11:65544005-65544027 GGAGGCCGGCGGCACCTCAGAGG - Intronic
1083882116 11:65553887-65553909 GGGGGGCGGGGCCTGCACTGGGG + Exonic
1083901867 11:65647175-65647197 GGAGGGCAGAGCCAGCCCCGGGG + Intronic
1084051750 11:66604761-66604783 GGAGGGCAGAGCCAGCTTCGAGG + Intronic
1084196336 11:67525126-67525148 GGAAGGAGGGGGCAGCACAGAGG - Intergenic
1084485392 11:69445014-69445036 GGAGGGCGGGGCCCGGACACGGG + Intergenic
1084498063 11:69516962-69516984 GGCAGGAGGGGGCAGCTCAGAGG - Intergenic
1084547203 11:69820364-69820386 GGAAGCAGGGGCCAGCACAGGGG + Intergenic
1085202201 11:74708535-74708557 GCAAGGCCCGGCCAGCTCAGAGG + Intronic
1086126650 11:83355623-83355645 GGATGGAGGAGCCAGCTAAGAGG - Intergenic
1086484637 11:87285775-87285797 TGAGGGTGGGGCCAGATAAGGGG - Intronic
1088495690 11:110429845-110429867 ATGGGGCGGGGCCAGCGCAGGGG - Intergenic
1089500614 11:118929425-118929447 GGAGGGCGGGGGCAGGGCGGGGG + Intronic
1090377858 11:126304029-126304051 TAGGGGCGGGGCCAGCGCAGGGG + Exonic
1090919123 11:131192844-131192866 GGAGGGAGGGGCCAGCTGTCAGG - Intergenic
1090919364 11:131194518-131194540 AGCGGGGTGGGCCAGCTCAGAGG - Intergenic
1091385809 12:93846-93868 GGAGGGAGGTGCCAGCTCTCAGG - Intronic
1091753312 12:3036044-3036066 GGAGACTGAGGCCAGCTCAGGGG + Intronic
1092016208 12:5161046-5161068 GGAGGGCAAGTCCAGTTCAGAGG + Intergenic
1094348561 12:29498037-29498059 GGAGTGCGGTCCAAGCTCAGGGG + Intergenic
1096149126 12:49297629-49297651 GCAGGGCGGGGCCTGGGCAGGGG + Intronic
1096652201 12:53067389-53067411 GCACGGGGGGACCAGCTCAGAGG + Intronic
1096670892 12:53197718-53197740 GGGAGGCGGGGCCAGGCCAGAGG - Intronic
1096817269 12:54209481-54209503 GCAGGGCAGGGTTAGCTCAGGGG + Intergenic
1102300361 12:111766906-111766928 GGGGAGCGGGGTCGGCTCAGTGG + Exonic
1102487768 12:113269730-113269752 GGAGAGATGGGCCAGCTCAGGGG - Intronic
1103325512 12:120117269-120117291 CGGGGCCGGGGCCAGCTCCGCGG - Intronic
1104304248 12:127594861-127594883 GGAGGGGAGGGCCAGAGCAGCGG - Intergenic
1104394477 12:128420464-128420486 GTAGGGGGAGGCGAGCTCAGAGG + Intronic
1104607837 12:130202990-130203012 GGAGGGTGGGGCAACCTCACAGG + Intergenic
1104714520 12:131007459-131007481 GGCCGGCGGGGCCTGCTCTGGGG + Intronic
1104738873 12:131158026-131158048 TGAGGGCGGGGCCAGCTTCATGG + Intergenic
1104934421 12:132356907-132356929 GGACGGCGGAGCCAGCTCCTCGG - Intergenic
1104949699 12:132433868-132433890 GGACAACGGGGGCAGCTCAGGGG - Intergenic
1104988557 12:132611278-132611300 GGAGGCCAGGGACAGCCCAGGGG + Intergenic
1105005665 12:132719083-132719105 GGGGGGCAGGGCCAGCTCTACGG + Intronic
1105293752 13:19071205-19071227 GGAGGGCGGGGCCAGGTGTGAGG - Intergenic
1106103042 13:26710545-26710567 GGTGGGAGGAGCCAGCTGAGCGG + Intergenic
1107286810 13:38802474-38802496 GGAAGGCAGGGCTATCTCAGTGG + Intronic
1112176475 13:97030312-97030334 GGAGGGTGGCGGCAGGTCAGAGG - Intergenic
1112207096 13:97335475-97335497 GGAGGGCAGGGCCTGCCCAAAGG + Intronic
1113650275 13:112029418-112029440 GCTGTGTGGGGCCAGCTCAGAGG + Intergenic
1114637391 14:24195581-24195603 GGAGGCCCGGCCCAGCTCCGGGG + Intronic
1115851793 14:37595162-37595184 GGCGGGCGGGGGCAGCGCCGGGG + Intronic
1119219474 14:72894207-72894229 GGTGGGCGGGGCCTGCGCCGTGG + Intergenic
1120269782 14:82296655-82296677 GGAGGGAGGGGCCAGGTGGGAGG - Intergenic
1121569615 14:94937207-94937229 GGAGGGGGGGGCCCTCTCGGCGG + Intergenic
1122810991 14:104287778-104287800 GGTGGCCTGGGGCAGCTCAGAGG + Intergenic
1123435320 15:20249901-20249923 GGAGGGCAGGGTCAGCCTAGAGG - Intergenic
1124179836 15:27462179-27462201 GGAGTGAGGAGCCGGCTCAGAGG - Intronic
1124631354 15:31339406-31339428 GCAGTGCGGGGGCAGCACAGAGG + Intronic
1124656909 15:31516275-31516297 GGATGGCGGGCCCAGTTGAGAGG + Intronic
1124956961 15:34366411-34366433 GGAGGGCCGCGCCAGCCTAGGGG - Intronic
1125688594 15:41578596-41578618 GGAGGGCAGGTCCAGCTCTGTGG + Exonic
1125856296 15:42953080-42953102 GGAAGGCTGGGCCAACTCAAAGG - Intronic
1126831544 15:52612377-52612399 GCAAGGCTGGGCCAACTCAGAGG - Intronic
1128318115 15:66673793-66673815 GGAAGGCGGGGCTGGCGCAGGGG - Intronic
1128365105 15:66994130-66994152 GGAAGGCAGGCCCAGTTCAGGGG - Intergenic
1129164363 15:73767952-73767974 GGAGGGCGGGGCCCAGTCCGAGG - Intergenic
1129270034 15:74414754-74414776 GGAGAGCAGGCCCAGGTCAGTGG + Intronic
1129379575 15:75156642-75156664 GGAGGGGGGGCCCTGCTCATTGG + Intergenic
1129390045 15:75215847-75215869 GGAGGCCTCTGCCAGCTCAGCGG + Intergenic
1129738984 15:77980726-77980748 GGAAGGCAGGGCCAGCTATGGGG + Intergenic
1129846970 15:78772449-78772471 GGAAGGCAGGGCCAGCTATGGGG - Intronic
1130254931 15:82321440-82321462 GGAAGGCAGGGCCAGCTATGGGG + Intergenic
1130600043 15:85268566-85268588 GGAAGGCAGGGCCAGCTATGGGG - Intergenic
1131174923 15:90203425-90203447 GGAAAGCTGGGCCAGCTCATGGG + Intronic
1131427568 15:92359500-92359522 GGGGGGCAGGGCCATGTCAGGGG - Intergenic
1131559648 15:93428357-93428379 TGAGGGTGTGGCCAGCTAAGAGG + Intergenic
1132128386 15:99251229-99251251 CGCGGGCGGGGCCAGCATAGAGG + Intergenic
1132365346 15:101252379-101252401 GGAGCGCGGGGCCGGCCCGGCGG - Intergenic
1132461647 16:58324-58346 GGAGCCCGCAGCCAGCTCAGTGG + Exonic
1132506829 16:314371-314393 GCAGAGCGCGGCCAGCTCAGAGG - Intronic
1132557824 16:580158-580180 GTAGGGAGGGGCCAGCACACCGG - Intronic
1132590735 16:725305-725327 GGAGGGCAGGGAAAGCTAAGGGG + Intronic
1132734725 16:1379703-1379725 GCGGGGCGGGGCCAGCGCGGAGG - Intronic
1132735792 16:1385260-1385282 GGGGGGCGCGGGCAGCGCAGTGG + Intronic
1132874986 16:2133139-2133161 GGAGGGCAGGGCAGGCTCTGGGG + Intronic
1132897875 16:2237474-2237496 GAGGGGCGGGGCCCGCTCACCGG - Exonic
1133166883 16:3954305-3954327 GGAGGGCAGGGACAGAGCAGAGG - Intronic
1133229782 16:4361018-4361040 GGAGGACGAGGCCAGCACATTGG + Exonic
1133279553 16:4657418-4657440 TGGGGGTGGGGCCAGCACAGTGG + Intronic
1133328684 16:4958059-4958081 GGAGGGCGGGGCCAGTGAAGGGG + Intronic
1133328750 16:4958265-4958287 CGTGGGCGGGACCAGGTCAGGGG + Intronic
1133775542 16:8892272-8892294 GGAGGGAAGGGCCAGGTCCGCGG + Exonic
1133779809 16:8929184-8929206 GGAAGGCATGGCCAGCTCTGAGG - Intronic
1134520004 16:14914251-14914273 GGAGGGCAGGGCAGGCTCTGGGG - Intronic
1134553929 16:15151986-15152008 GGAGGGCAGGGCAGGCTCTGGGG + Intergenic
1134707677 16:16312905-16312927 GGAGGGCAGGGCAGGCTCTGGGG - Intergenic
1134959866 16:18399220-18399242 GGAGGGCAGGGCAGGCTCTGGGG + Intergenic
1135415379 16:22264736-22264758 GGAGGGCTGGACCAGCTCTCAGG + Intronic
1135783268 16:25324944-25324966 GGAGGTCGGGGAGAGCCCAGGGG + Intergenic
1135933094 16:26756271-26756293 GGTGGGAGGGGCCAACCCAGGGG - Intergenic
1136449631 16:30346442-30346464 GGAAGGCTGGGCCAGGTAAGAGG + Intergenic
1136455610 16:30378255-30378277 GGTGGGCGGGACCAGCGCCGGGG + Exonic
1137320008 16:47370787-47370809 AGAGGGCAGTGCCAGCCCAGAGG + Intronic
1137615456 16:49843784-49843806 GAGGGGTGGGGCCAGCTAAGTGG - Intronic
1139475930 16:67202553-67202575 GGAGGCCTGGGCCAGGGCAGGGG + Intronic
1139657227 16:68396330-68396352 GGAGGGCAGGGCCTGGTCACTGG - Intronic
1139910811 16:70396375-70396397 GGTGAGCAGGGCCTGCTCAGGGG + Intronic
1142158183 16:88542493-88542515 GGAAGGAGGGGCCAGCTCTCTGG - Intergenic
1142269266 16:89080628-89080650 GGGGGGCGGGCCCAGATCATGGG - Intergenic
1142498849 17:321243-321265 CGGGGCCGGGGCCAGCTCAGTGG - Intronic
1142504974 17:357635-357657 GGAGAGCTGGGCCAGGCCAGTGG + Intronic
1142640993 17:1285922-1285944 GGAGGGAGCGGCCAGCTCCGAGG + Intronic
1142712583 17:1731314-1731336 GGAGGGGGTGGGAAGCTCAGGGG + Intronic
1143098911 17:4494123-4494145 GGAGGGCCGGCCGAGCACAGTGG + Intergenic
1143200570 17:5110557-5110579 GCAGGGAGGAGCCATCTCAGAGG - Intronic
1143269337 17:5664345-5664367 GGAGGTCTTGGCTAGCTCAGAGG + Intergenic
1144124974 17:12194850-12194872 GGTGGATGGGGCCAGCTCACAGG - Intergenic
1144738309 17:17567139-17567161 GGAGGGATGGGCCGGCTCAGTGG + Intronic
1144772353 17:17766862-17766884 GGTGGCAGGGGCCAGCTCAGGGG + Intronic
1146061135 17:29607958-29607980 GGAGGGCGAGGCAAGGTCACAGG - Intronic
1146064341 17:29622906-29622928 AGAGGGCGGGGCTAGCATAGGGG + Intronic
1146256951 17:31397206-31397228 GGAAGGTAGGGCCAGATCAGTGG + Intronic
1146305319 17:31725820-31725842 GAAGGGTGGGGCCTGCTGAGGGG + Intergenic
1146650297 17:34602269-34602291 TGCGGGCTGGGCCAGCCCAGGGG - Intronic
1147560772 17:41507566-41507588 GGAGGGCCGGGCAGGGTCAGGGG - Intergenic
1147741857 17:42674556-42674578 GGCGGGAGGGGCGAGCCCAGGGG - Intronic
1147786398 17:42981216-42981238 GGAGTGCGGGGCCGGCTGAAGGG + Intronic
1147871601 17:43591514-43591536 GGAGAGCTGGGCCATTTCAGGGG + Intergenic
1148324001 17:46772865-46772887 GGAGGGAGGGCCAGGCTCAGCGG + Intronic
1148741733 17:49897092-49897114 GGAGGGTGGGGCCAGCCCTGAGG - Intergenic
1148796911 17:50201459-50201481 GGAGGGCGGTGGCCGCTAAGAGG + Exonic
1149503639 17:57174843-57174865 CGAGGCAGGAGCCAGCTCAGGGG + Intergenic
1149541664 17:57472315-57472337 AGGGGGCAGGGCGAGCTCAGGGG + Intronic
1150251613 17:63708022-63708044 GTTGGGCGGGCCCAGCGCAGTGG - Intronic
1150294412 17:64000154-64000176 TGAGGCCGGGGACAGCTCAGTGG + Intronic
1150621608 17:66812018-66812040 GAAGGTCAGGGCCAGCCCAGTGG - Intergenic
1151497242 17:74466282-74466304 GGTGAGAGGAGCCAGCTCAGCGG + Intergenic
1151906704 17:77053772-77053794 TGAGCGCGGGGCCTGCTCAGGGG + Intergenic
1152070718 17:78132460-78132482 GGGGGGCGGAGCCAGACCAGGGG - Exonic
1152376606 17:79921893-79921915 GGCGGGCAGGGCCTCCTCAGAGG - Intergenic
1152621549 17:81367378-81367400 GGTGGGCGGGGCCTCCCCAGGGG - Intergenic
1152642087 17:81453597-81453619 GCAGGGCAGGGGCAGCTCTGGGG - Intronic
1152675342 17:81637186-81637208 GGATGGCGGGGGCGGGTCAGCGG - Exonic
1153006188 18:500485-500507 GTAGGGCGGCGGCAGCTCCGCGG - Intronic
1153669117 18:7393547-7393569 GGGAGGCAGGGCCAGCTCTGTGG - Intergenic
1157451420 18:47792007-47792029 GGTGAGCAGGGGCAGCTCAGGGG - Intergenic
1160273430 18:77408836-77408858 GGAGGGAGGGGGCAGCGCAAAGG + Intergenic
1160454671 18:78992351-78992373 GGAGGGCGAGGCCAGGCCGGTGG + Exonic
1160754015 19:748362-748384 GGAAGGCGTGGCCAGGCCAGGGG + Intergenic
1160911495 19:1475920-1475942 TGAGAGCCAGGCCAGCTCAGTGG - Intronic
1161112993 19:2480011-2480033 GGGAGGCGAGGCCAGCTCGGAGG + Intergenic
1161153359 19:2720843-2720865 ACAGTGCGGGGCCAGCCCAGGGG + Intronic
1161238185 19:3208198-3208220 GGAGGGCAGTGCCAGCCCTGGGG + Exonic
1161252081 19:3285773-3285795 TGGGGGCGGGGCCAGGCCAGAGG - Intronic
1161505063 19:4639451-4639473 GGAGGGCGTGGCCTGCCGAGGGG + Intergenic
1161541022 19:4851654-4851676 GGAGGGCGGGGAGAGGACAGGGG + Intronic
1161562404 19:4980950-4980972 GGTGGGCGGGGTCAGCTTGGCGG + Intronic
1161960763 19:7521963-7521985 GGAGGTAGGAGCCAGATCAGAGG + Intergenic
1162019906 19:7863659-7863681 GTAGGGCGCGGCCAGCTCATCGG - Exonic
1162021807 19:7871501-7871523 AGAGGGCGGGGCCTGCATAGGGG + Exonic
1162046670 19:8005151-8005173 GGAGAGTGGGGCCAGCTACGGGG - Intronic
1162144595 19:8605813-8605835 GGAGGGGGGAGCCAGGTAAGGGG + Intronic
1163026780 19:14517591-14517613 GGAGAGCGGGGCCGCCTCGGAGG - Intronic
1163282172 19:16324824-16324846 GGCGGGCGGGGACGGCTCTGTGG - Exonic
1163666816 19:18607226-18607248 GGGGGGCGGGGCCAGAGCTGGGG - Intronic
1163672458 19:18636961-18636983 GCGGGGCGGGGCCAGGTCTGCGG - Exonic
1163700579 19:18784761-18784783 GGAGGGCTGGGACAGCTTTGAGG + Intronic
1163848208 19:19649423-19649445 GGAGGGGGTGGCAAGGTCAGGGG - Intronic
1164624115 19:29715252-29715274 GGAGGGCGGGGCCAGCGCCGGGG - Intronic
1164783857 19:30913940-30913962 GGAGGCAGGGGCCAGATCACAGG + Intergenic
1165060624 19:33203676-33203698 GGAAGGCAGGGCCAGCACACAGG + Intronic
1165430580 19:35769591-35769613 GGAGGGGGGGCCCAGCACGGTGG - Intronic
1165431654 19:35776394-35776416 GGAGCGTGGGGCCTGCACAGAGG - Intronic
1165760728 19:38319893-38319915 GGAGGCGGGGGCCACGTCAGCGG + Exonic
1165808691 19:38597274-38597296 AGTGGGCGGGGCCAGGCCAGAGG - Intronic
1166136494 19:40780329-40780351 GGAGAGAGGAGACAGCTCAGAGG - Intronic
1166310324 19:41958953-41958975 GGGGGGTGGGGCCGGGTCAGTGG + Intronic
1166853241 19:45770305-45770327 GGAGGGAGGGGCCGGGTCCGCGG - Exonic
1167428826 19:49442955-49442977 GGAGGGCGGGGACAGATCTCAGG - Intergenic
1167476951 19:49706667-49706689 GGTCGGAGGGTCCAGCTCAGGGG - Intronic
1167512209 19:49901431-49901453 GGTGGGCAGGGCCTGCCCAGGGG + Intronic
1167950099 19:53019567-53019589 GGAAGGCTGGGGCAGCTCAGTGG - Intergenic
1168243298 19:55097825-55097847 GTGGGGCAGGGTCAGCTCAGGGG - Intronic
1168289862 19:55352392-55352414 GTAGGGCTGGGTGAGCTCAGGGG - Intronic
1168567641 19:57438374-57438396 GGAGGGCTGTGGAAGCTCAGGGG + Exonic
1168629729 19:57947406-57947428 GGAGGGCGGGGAAGGCCCAGAGG + Intronic
925832583 2:7910614-7910636 TGCTGGCAGGGCCAGCTCAGAGG + Intergenic
926135155 2:10331164-10331186 AGAGGGCGGGGCGGGCTCTGGGG + Intronic
926677976 2:15642489-15642511 GGAGGGCTGGCTCAGCTCAGAGG + Intergenic
927089194 2:19697742-19697764 GGATCCCGGGGCCAGCACAGGGG - Intergenic
927706981 2:25302482-25302504 GGAGGGAGAGGCCAGCCCCGAGG + Intronic
927783274 2:25955711-25955733 GGAGGGCCAGGAAAGCTCAGGGG + Intronic
927912181 2:26907556-26907578 GGAGGGCAAGGTCAGATCAGGGG - Intronic
928390891 2:30910229-30910251 GGAGAGTGGGACCAGATCAGGGG - Intergenic
929575115 2:43046595-43046617 GGACGGCGGGGCGAGTGCAGAGG - Intergenic
929779780 2:44949970-44949992 GGAGGGCGGGGGCAGGCGAGAGG + Intergenic
932407955 2:71526419-71526441 GGCGGGCGGGGTCAGCTCCCTGG + Intronic
932501035 2:72182777-72182799 TCAGGGCGGGGACAACTCAGAGG + Intronic
934615755 2:95769619-95769641 GGGAAGTGGGGCCAGCTCAGGGG - Intergenic
934645137 2:96054938-96054960 GGGAAGTGGGGCCAGCTCAGGGG + Intergenic
934838541 2:97611027-97611049 GGGAAGTGGGGCCAGCTCAGGGG + Intergenic
935734507 2:106096082-106096104 AGTGTGCGGGGCCAGGTCAGGGG - Intronic
937251804 2:120528588-120528610 GGAGGTCTAGGCCAGCTCAGTGG - Intergenic
937956354 2:127423588-127423610 GGAGGGCGCGCCCAGCTCCCGGG - Intronic
938252600 2:129827460-129827482 GGCGGGCGGGGCCGGCTGAAGGG + Intergenic
940757521 2:157699776-157699798 GGAGGTGGGAGCCAGCTAAGTGG - Intergenic
946315579 2:218909233-218909255 GGAGGGCGGGGATGGGTCAGCGG + Intergenic
946402740 2:219477062-219477084 GGAGGGCGGAGCCCGGGCAGAGG + Intronic
947418519 2:229921818-229921840 GGGGGAGGGGGCCAGCTGAGGGG - Intronic
947841109 2:233208524-233208546 GCAGGGCGGGGACACCTGAGTGG - Intergenic
948598913 2:239097052-239097074 GGAGGGCCCGGCCAGCTGAGGGG + Intronic
948612352 2:239178028-239178050 CGAGAGCGGAGCCATCTCAGAGG - Intronic
948716039 2:239864496-239864518 GGAGGGTAGGGGGAGCTCAGAGG + Intergenic
948893119 2:240916530-240916552 GGAGCGCGGGGGGAGCGCAGGGG - Intergenic
1168872936 20:1146434-1146456 GGAGGGTGGGGCCAGATTTGGGG + Intronic
1171878343 20:30598601-30598623 GGAGGGCGGGGCCAGGTGTGAGG - Intergenic
1172167340 20:32907353-32907375 CGAGGGCAGGGGCAGCGCAGGGG - Intronic
1172674047 20:36654771-36654793 GCGGGGCAGGGCCAGCACAGAGG + Intronic
1172688290 20:36773592-36773614 GGCGGGCGGGGCCACATCAGAGG + Exonic
1173019837 20:39257916-39257938 GGATGGCTGGGGCAGCTCTGTGG + Intergenic
1173353433 20:42265536-42265558 GGAGAGAGGGGGCAGCTCTGGGG - Intronic
1173463315 20:43261399-43261421 GCAGGGCTGGGGCAGCTCTGGGG - Intergenic
1173585267 20:44177322-44177344 GGAGGGCAGGGCCTGCTCCGGGG + Intronic
1173662385 20:44743746-44743768 GAAGGGCAGGGCCCACTCAGGGG - Intergenic
1174128238 20:48324377-48324399 GGAGGGCTGGACCAGGGCAGAGG - Intergenic
1175036074 20:56003343-56003365 GGAGGGCGGGGGCAGAGCCGGGG - Intronic
1175278653 20:57788276-57788298 GGAGGGTGGGGTCTGCTCGGGGG - Intergenic
1175319346 20:58074416-58074438 GGAGGGAAGGGACAGCTCAGTGG + Intergenic
1175331296 20:58166333-58166355 GGATGCCAGGGCCATCTCAGAGG - Intergenic
1175826360 20:61938552-61938574 GCAGGGCGGTGCCAGCACTGGGG + Exonic
1175919010 20:62441332-62441354 CAAGGTCGGGGTCAGCTCAGAGG + Intergenic
1175944218 20:62551251-62551273 GGAGGGCGCGTCCAGCTGGGAGG + Intronic
1175958052 20:62621418-62621440 GGAGGGCGGGGCATGGTGAGCGG - Intergenic
1176083894 20:63287168-63287190 AGAGGGCAGGGCCAGATCTGGGG + Intronic
1176213706 20:63938637-63938659 GGGGGGCGGGGCCAGCGCGGGGG + Intergenic
1176213714 20:63938654-63938676 CGGGGGCGGGGCCGGCTCAGGGG + Intergenic
1176425364 21:6545396-6545418 GTAGGGCGGAGCCAGCGCACAGG + Intergenic
1178480627 21:32976916-32976938 GGAGGCCGGGGCCTGTCCAGTGG + Intergenic
1178513919 21:33230246-33230268 GGAGCGCGTGGCCAGCTGACTGG + Intronic
1179700855 21:43153713-43153735 GTAGGGCGGAGCCAGCGCACAGG + Intergenic
1179731345 21:43369433-43369455 GGAGGGCAGGGGGAGCGCAGGGG + Intergenic
1179922101 21:44512908-44512930 GGGGGCCGGGGGCGGCTCAGAGG + Intronic
1180748834 22:18110818-18110840 GGCGGGCAGGCCCAGCTGAGAGG + Exonic
1180800047 22:18627429-18627451 CGGGGGCGGGGCCAGCTCTAGGG + Intergenic
1181031053 22:20149079-20149101 GGAGGGCAGGTCCAGGGCAGGGG - Intronic
1181221668 22:21367837-21367859 CGGGGGCGGGGCCAGCTCTAGGG - Intergenic
1181635510 22:24172543-24172565 TGAGGGCAGGGGCAGGTCAGGGG + Intronic
1181636965 22:24178952-24178974 GCAGGGCTGGGGCAGCTGAGAGG + Intergenic
1181638329 22:24184484-24184506 GGTGGGAGGGGGCAGCTCATGGG + Intronic
1181694011 22:24584067-24584089 GGTGGGAGGGGCCAGCAGAGAGG - Intronic
1182123658 22:27801622-27801644 GGGGCGCGGGGGCAGCTCTGGGG + Intergenic
1182501839 22:30753578-30753600 GGAGGGCTGGACAGGCTCAGTGG + Intronic
1182522743 22:30893438-30893460 GGAGGCAGGGGACAGGTCAGAGG - Intronic
1182874793 22:33682358-33682380 GGAGGCCAGGGCCAGATCACAGG - Intronic
1183248661 22:36712807-36712829 GGGAGGCGGGGCCTGGTCAGGGG + Intergenic
1183507882 22:38219636-38219658 GGAGGGTGGGGGGAGCTCAGTGG - Exonic
1183999297 22:41660599-41660621 GGAGGACAGGGCCAGCAGAGAGG - Intronic
1184136648 22:42553847-42553869 GGAAGGCGGGGCCTTCTGAGTGG + Intronic
1184189632 22:42886118-42886140 TGAGGGCAGGGGCAGCCCAGAGG - Intronic
1184348084 22:43925175-43925197 GGAGGGTGGGCCTAGGTCAGTGG - Intronic
1184930584 22:47678174-47678196 GGAGAGTGAGGCCTGCTCAGAGG - Intergenic
1185005913 22:48276979-48277001 GCAGGGCAGGGCCAGACCAGAGG - Intergenic
1185015207 22:48338895-48338917 AGAGGCCGGGCCCTGCTCAGGGG - Intergenic
1185171691 22:49298082-49298104 CGTGGGAGGGGCCAGGTCAGAGG + Intergenic
1185342735 22:50299002-50299024 GGAGGGCAGGCCCAGCTTGGGGG + Intronic
1185399429 22:50608288-50608310 AGACTGCGGGGCCAGCTCTGGGG + Intronic
1185399446 22:50608345-50608367 AGACAGCGGGGCCAGCTCTGGGG + Intronic
1185399491 22:50608511-50608533 AGACAGCGGGGCCAGCTCTGGGG + Intronic
1185399567 22:50608786-50608808 AGACGGTGGGGCCAGCTCTGGGG + Intronic
1185418297 22:50721534-50721556 GGGGGCCGGGGCCAACTCCGGGG - Intergenic
949155689 3:825085-825107 GGAGGGAGGGACCAGGTGAGAGG + Intergenic
950525107 3:13518797-13518819 GGAAGGCGGCGCCTGCTGAGGGG + Intergenic
952493291 3:33892646-33892668 GGAGGGCGGGAGAAGGTCAGAGG + Intergenic
953678417 3:45021293-45021315 AGAGGGTGTGGCCAGCTGAGGGG - Intronic
954117832 3:48476974-48476996 GGTGACTGGGGCCAGCTCAGAGG - Intronic
954707148 3:52487169-52487191 GCAGGGAGAGGCCAGGTCAGTGG - Intronic
956420263 3:69080076-69080098 GGAGGCCGGGGCCCTCTCCGGGG - Intronic
959622751 3:108415839-108415861 GGAGGCTGGAGCCAGATCAGGGG + Intronic
960972661 3:123150687-123150709 AGGGGGCGGGGACAGCTGAGGGG - Intronic
961009015 3:123423797-123423819 GGGGAGGGTGGCCAGCTCAGTGG + Intronic
961553116 3:127680241-127680263 AGCGGGAAGGGCCAGCTCAGTGG - Intronic
961658929 3:128458138-128458160 GGAGGTCACAGCCAGCTCAGAGG + Intergenic
962441582 3:135423416-135423438 TGAGGGCTGGGCCACCTCACAGG + Intergenic
962647103 3:137451133-137451155 GTAGGGAGGAGCCAGCTCACAGG + Intergenic
964282343 3:155080087-155080109 GGAGGGCAGAGCCAGCCGAGGGG + Intronic
966508644 3:180735946-180735968 GGAGTCAGGGCCCAGCTCAGGGG - Intronic
967979308 3:195056036-195056058 GGAGGAGGGGGCCAGGTCGGTGG - Intergenic
968266559 3:197367577-197367599 GGAGGGCAGGCCCAGCTCCTGGG + Intergenic
968500801 4:949036-949058 GGAGGGCGGGAGCGGCTCTGGGG - Intronic
968506577 4:973717-973739 GCGGGGCGGGGCCTGCTAAGGGG + Intronic
968598200 4:1496098-1496120 ATCGTGCGGGGCCAGCTCAGGGG + Intergenic
968899773 4:3425779-3425801 GGTGAGCGGGGCCAGTGCAGGGG + Intronic
968899791 4:3425832-3425854 GGCGAGCGGGGCCAGTGCAGGGG + Intronic
968899809 4:3425885-3425907 GGTGAGCGGGGCCAGTGCAGGGG + Intronic
968899827 4:3425938-3425960 GGCGAGTGGGGCCAGCGCAGGGG + Intronic
968899857 4:3426015-3426037 GGTGAGCGGGGCCAGTGCAGGGG + Intronic
968899875 4:3426068-3426090 GGCGAGCGGGGCCAGTGCAGGGG + Intronic
968899955 4:3426280-3426302 GGCGAGCGGGGCCAGTGCAGGGG + Intronic
968920695 4:3521008-3521030 GGAGGGCGAGGCCAGCCCCCAGG - Intronic
968970356 4:3790464-3790486 GGTGGGCTGGAGCAGCTCAGAGG - Intergenic
969365190 4:6690111-6690133 GGAGGGCGGGGCCTGTGCTGGGG - Intergenic
969417177 4:7068328-7068350 AGGGGGCGGGGCCAGCGCCGGGG + Intergenic
969499919 4:7546408-7546430 GGAGGTGGGGGGCAGCGCAGAGG - Intronic
969512821 4:7629432-7629454 GCAGGGCAGGCCCAGCTGAGAGG + Intronic
969589293 4:8112520-8112542 GGATGGAGGGGTCAGATCAGGGG + Intronic
970446305 4:16125903-16125925 AGAGGCAGGGGCCAGCTCTGTGG + Intergenic
971052749 4:22879622-22879644 GGAGGTCAGGGAAAGCTCAGGGG - Intergenic
972281135 4:37603192-37603214 GGAGCGAAGGGCCAGCTCTGTGG + Intronic
975166999 4:71187703-71187725 GGACTGCGGGGCCAGTTCTGCGG + Intronic
978472810 4:109089075-109089097 GGAGGGCTGGACAAGCACAGTGG + Intronic
982564679 4:156971924-156971946 GGCGAGCGGGGGCGGCTCAGCGG + Intergenic
985524413 5:394799-394821 GGTGGGCAGGGCCAGCTCCTGGG + Intronic
985610166 5:883461-883483 GGAGAGCGTGGTCAGCTGAGTGG + Intronic
985660855 5:1155908-1155930 GGAGGGCGGGGCCGGCGGGGCGG + Intergenic
985714246 5:1446543-1446565 GGAGTGCGGGGCGGGCGCAGGGG - Intergenic
985791396 5:1930513-1930535 GCACAGCGGGGCCAGCACAGGGG - Intergenic
986091572 5:4513296-4513318 GCAGGGAGGGGCCAGGTGAGGGG + Intergenic
986731293 5:10636735-10636757 GGATGGAGGTGGCAGCTCAGGGG + Intronic
986779763 5:11054550-11054572 GGAAGGCGGGAGCAGCTGAGGGG - Intronic
987340643 5:16936294-16936316 GGAGGGCGGGGCGAGGTCGCTGG - Intergenic
989099906 5:37813848-37813870 GGTGGTCGGGGCCAGTGCAGCGG - Intronic
990148299 5:52787877-52787899 GGAGGGTGTTGCCAGCCCAGTGG - Exonic
992105574 5:73447385-73447407 GGCGGTCCGGGCCAGCTCGGCGG + Exonic
992175298 5:74143871-74143893 CCAGGGCGGGGCCAGCTCTATGG + Intergenic
992910791 5:81394163-81394185 GGAGGGCGGGGCGGGCGGAGCGG - Intronic
993127183 5:83850121-83850143 GGAGGGTAGGGCCAAATCAGGGG - Intergenic
994118730 5:96090414-96090436 GGAGGATGCTGCCAGCTCAGTGG - Intergenic
997129614 5:131263924-131263946 GGGGGGCGGGGCCAGCACTGCGG + Intronic
998018827 5:138753347-138753369 GGCGGGCGGGGCCGGGACAGGGG + Intronic
998148783 5:139745519-139745541 GGTGGGCGGGGCCGACGCAGTGG + Intergenic
998394085 5:141806964-141806986 TGTGGGCTGGGTCAGCTCAGAGG + Intergenic
998461744 5:142314875-142314897 GGGCGTCGGGGCCAGCTCTGGGG + Exonic
999142019 5:149368516-149368538 GGAGTGGGCGGCCAGCTCCGTGG + Exonic
1000024624 5:157347922-157347944 GGTGAGCGGCGACAGCTCAGAGG - Intronic
1000040416 5:157480835-157480857 GGAGGGTGGGAGGAGCTCAGAGG + Exonic
1001197452 5:169686319-169686341 GGATGGCTGGACCAGCTCTGTGG + Intronic
1002181695 5:177434109-177434131 GGAGGGCTCGGCCACCCCAGGGG + Intronic
1002209937 5:177592542-177592564 GCAGGGCGAGCCCAGGTCAGAGG - Intronic
1002449974 5:179313233-179313255 GGAGGGCCTGGCCAGAGCAGGGG + Intronic
1002449987 5:179313315-179313337 GGAGGGCCTGGCCAGAGCAGGGG + Intronic
1002450000 5:179313397-179313419 GGAGGGCCTGGCCAGAGCAGGGG + Intronic
1002450013 5:179313479-179313501 GGAGGGCCTGGCCAGAGCAGGGG + Intronic
1002450025 5:179313561-179313583 GGAGGGCCTGGCCAGAGCAGGGG + Intronic
1002450050 5:179313733-179313755 GGAGGGCCTGGCCAGAGCAGGGG + Intronic
1002636889 5:180613013-180613035 GGCGGGAGTGGCCAGCTCCGGGG + Exonic
1002712641 5:181204527-181204549 GGAGCGCGGGACCAAGTCAGGGG + Intronic
1002929574 6:1624140-1624162 GGAGGGCGGGCCGGGCTCCGAGG + Exonic
1005851723 6:29827957-29827979 GGAGGGAGGGGCCGGCCCGGCGG + Intronic
1005977869 6:30813991-30814013 GGAGGGCAGGAGCAGGTCAGAGG + Intergenic
1006579998 6:35071686-35071708 GGAGCGTGTGGCCAGCTCAGGGG - Intronic
1006694667 6:35920904-35920926 GTGGGGCGGCGCCACCTCAGTGG + Intronic
1007586710 6:42995058-42995080 GAAGAGTGGGGCCAGCTCAGAGG - Intronic
1007664502 6:43506375-43506397 GGAGGGAGGAGACAGCTGAGGGG - Exonic
1007690742 6:43699596-43699618 GGAGGGAGAGGCCAGGACAGGGG + Intergenic
1007775746 6:44223531-44223553 GCAGGGCGGGGCGAGCTCAGCGG + Intronic
1009526281 6:64750897-64750919 GGAAGGGAGGGGCAGCTCAGGGG - Intronic
1012132854 6:95518985-95519007 GCAGGGCTGGGCCAGCCCAGGGG - Intergenic
1013420499 6:109962476-109962498 GGAGGGAGTGGCCAGTTCAAAGG + Intergenic
1013708929 6:112874707-112874729 GCTGCTCGGGGCCAGCTCAGTGG - Intergenic
1015024650 6:128519495-128519517 GGAGCGCGGGGCCAGCCTGGCGG + Intronic
1017325216 6:153134353-153134375 TGAGGGTGGGGCCAGATAAGAGG + Intergenic
1018103190 6:160459254-160459276 GCAAGGCAGTGCCAGCTCAGAGG - Intergenic
1018111159 6:160538053-160538075 GCAAGGCAGTGCCAGCTCAGAGG - Intronic
1018125266 6:160676608-160676630 GCAAGGCAGTGCCAGCTCAGAGG - Intergenic
1018988654 6:168656930-168656952 GGATGGCCGGGCCAGCACAGGGG - Intronic
1019194982 6:170275921-170275943 GGAAGCCTGGGCCAGCACAGTGG + Intergenic
1019286102 7:223938-223960 GGAGGGCCGGGCAGGCTCAGGGG - Intronic
1019596537 7:1861004-1861026 GGAGGGGCGGGCCAGGACAGAGG - Intronic
1019689914 7:2404555-2404577 GGTGGTTGGGGACAGCTCAGCGG + Intronic
1020000661 7:4753871-4753893 TGAGGGCAGGGGCATCTCAGCGG + Intronic
1020084418 7:5302933-5302955 AGTGGGCGGGGCTGGCTCAGAGG - Exonic
1023522383 7:41061317-41061339 GGAGTGTGGTGCCAGCTCTGTGG - Intergenic
1023841672 7:44101788-44101810 GGAGGGTGGGGCCTGCGCTGGGG - Intergenic
1024308547 7:47948233-47948255 GGCCGGCGGGGTCAGTTCAGAGG - Intronic
1025209876 7:57014266-57014288 AGTGGGCGGGGCTGGCTCAGAGG + Intergenic
1025211204 7:57020405-57020427 GGAGGGCGGGGCCGGCGGGGAGG - Intergenic
1025660751 7:63556442-63556464 GGAGGGCGGGGCCGGCGGGGAGG + Intergenic
1025662075 7:63562585-63562607 AGTGGGCGGGGCTGGCTCAGAGG - Intergenic
1031359663 7:120833792-120833814 GGAAAGCAGTGCCAGCTCAGGGG - Intronic
1032077213 7:128841619-128841641 GGAAGGCAGGGCCAGGCCAGAGG + Intronic
1032094848 7:128932848-128932870 GGATGGCAGGGCCAGCCCAAGGG - Intergenic
1033214338 7:139483024-139483046 AGAGGGCCGGGCCAGCCCCGCGG - Exonic
1033662063 7:143408893-143408915 GGGGGGCGGGGCCAGCGCCGGGG + Intergenic
1034270710 7:149802329-149802351 GGAGGGCAGGGCCAGCCGGGAGG - Intergenic
1034402788 7:150876940-150876962 GGGGGGTGGGGGGAGCTCAGCGG - Intergenic
1034561041 7:151879394-151879416 GGAGGGCAGGGGAAGTTCAGAGG - Intergenic
1035027276 7:155834231-155834253 GGAGGACGGGGGCTGCCCAGTGG + Intergenic
1035055011 7:156029278-156029300 GCCTGGTGGGGCCAGCTCAGGGG + Intergenic
1035068030 7:156122108-156122130 GGAGGACGGGGACAGGTCAAGGG + Intergenic
1035216613 7:157372373-157372395 CGAGGACGGGGCCAGCCCTGGGG + Intronic
1035388223 7:158488725-158488747 GGATGGCGGGGCCTGCCCAGAGG - Intronic
1035764951 8:2098451-2098473 GCAGGGCAGGGCCCGCTCAGGGG + Intronic
1036229150 8:6984824-6984846 GGAGTGCTGGGCTGGCTCAGTGG - Intergenic
1036231603 8:7003929-7003951 GGAGTGCTGGGCTGGCTCAGTGG - Intronic
1037828908 8:22176936-22176958 GGAGGGCGGGGCCAGCTCAGGGG - Intronic
1038451191 8:27639975-27639997 GGAGGCAGGGCCCAGCTCAAAGG + Intronic
1039893575 8:41700603-41700625 GGTGGGCTGGATCAGCTCAGTGG - Intronic
1039910935 8:41826359-41826381 GGAGGAAGGGACCAGCTCTGAGG - Intronic
1040936763 8:52789625-52789647 GGAGAGCTGGGCCAGATCACGGG - Intergenic
1041570579 8:59333265-59333287 GGAGGGTGGGGGCAGCACAGTGG - Intergenic
1042724619 8:71860345-71860367 GGAGGGCTTGCTCAGCTCAGTGG - Intronic
1043380646 8:79698341-79698363 GGAAGGGATGGCCAGCTCAGTGG - Intergenic
1045099022 8:98826116-98826138 GGAGCTCTGGGCCAGCTCAGAGG - Intronic
1046101280 8:109616849-109616871 GGATGGTAGGGCCAGCACAGTGG + Intronic
1047208427 8:122821324-122821346 TGGGGGCTGGGCCAGCTCCGTGG + Intronic
1048216219 8:132498141-132498163 GGTGGGTGGGGTCAGGTCAGGGG - Intergenic
1048373404 8:133800217-133800239 GGTTGGCGTGGCCAGCTGAGAGG + Intergenic
1048494629 8:134924975-134924997 GGATGACGGGGACAGGTCAGAGG + Intergenic
1049206760 8:141367169-141367191 GGAGGCTGGGGCCAGCCCACAGG + Intronic
1049272162 8:141701559-141701581 TGGGGCCGGGGCCAGCGCAGGGG - Intergenic
1049803430 8:144528601-144528623 GGTGGGCGGGGCCTGCGCGGTGG - Intronic
1049812220 8:144580674-144580696 GGTGGGCGGGGCCAGGTGAGTGG - Intronic
1050176827 9:2876951-2876973 GGAGGGCAGGGCTTGCCCAGAGG + Intergenic
1050815453 9:9806336-9806358 CGATGGTGCGGCCAGCTCAGAGG - Intronic
1053000331 9:34574206-34574228 GAAGGGCGGGCCTAGGTCAGGGG + Intronic
1054856830 9:69909397-69909419 GCAGGGCCAAGCCAGCTCAGTGG + Intergenic
1057266588 9:93621612-93621634 GGAGGGCGGGGCCAGGTGTGAGG + Intronic
1057798434 9:98174571-98174593 GGAGGGAGGGGCCTGGTGAGAGG + Intronic
1058439088 9:104991222-104991244 GGCGGGCGGGGCCGGCGCTGGGG - Intergenic
1058986441 9:110212452-110212474 GGAGGGAGGGGACAGGTAAGAGG - Intergenic
1059479300 9:114576019-114576041 GTAGGCAGGGGCCAGCTCAGTGG - Intergenic
1060553246 9:124495527-124495549 GGAAGGAGGGGCCTGCCCAGGGG + Intronic
1060556601 9:124511276-124511298 GGTGGGAGGGGGCAGCACAGAGG - Intergenic
1060724312 9:125997087-125997109 GGAGGGCTGAGCCAGCTGCGAGG - Intergenic
1060829764 9:126706123-126706145 GGTGGGAGGTGGCAGCTCAGGGG - Intergenic
1061044986 9:128160162-128160184 GTAGGGCGGGGCCAGAACAGCGG + Intergenic
1061089744 9:128420262-128420284 GGAGGACGCGCCCAGCTCAGGGG + Intronic
1061188989 9:129070941-129070963 GGAGAGTGGGGCCACCTTAGTGG + Exonic
1061307942 9:129743189-129743211 GGAGGGCTGGGCCAGCCCCAGGG - Intronic
1061318952 9:129815722-129815744 GGAAGGACGGGCGAGCTCAGTGG - Intronic
1061319217 9:129817328-129817350 GGATGCCGTGGGCAGCTCAGGGG - Intronic
1061791286 9:133060657-133060679 GGAGGGCTGGGGCAGGGCAGAGG - Intergenic
1061793469 9:133070875-133070897 GGTGCCCAGGGCCAGCTCAGAGG + Intronic
1061796078 9:133086674-133086696 GGTGCCCAGGGCCAGCTCAGAGG + Intronic
1061796584 9:133088918-133088940 GGATGGCGGGTGCAGCCCAGAGG - Intergenic
1061866500 9:133494149-133494171 GGAGAGCCGGGGCAGGTCAGAGG + Intergenic
1062026676 9:134343836-134343858 GGAAGGCGGGGCCAGCTGGCTGG + Intronic
1062278012 9:135739695-135739717 GGAGGGCGGGGGCACCTCAGGGG - Intronic
1062349793 9:136133157-136133179 CGGGGGCGGGGCAAGCTTAGGGG - Intergenic
1062355615 9:136160614-136160636 GGAAGGCCGGGCCAGCTGAGGGG + Intergenic
1062358853 9:136178009-136178031 GGAGAGCGGGGACAGCACTGGGG + Intergenic
1062504440 9:136865974-136865996 GGAGGACCGGGCCAGGACAGGGG - Intronic
1062517734 9:136944609-136944631 GCAGGGCGGGGGCGGCGCAGCGG - Exonic
1062526020 9:136978446-136978468 GAGGGGCGGGGCCATCTCCGGGG + Intronic
1062526099 9:136978651-136978673 GAAGGGCGGGGCCAGCTCTTGGG + Intronic
1062614426 9:137389565-137389587 AAAGGGCGGTACCAGCTCAGGGG + Intronic
1062615030 9:137392467-137392489 GCGAGGCGGGGCCAGCACAGGGG + Intronic
1062651165 9:137578577-137578599 GGAGGGCGGGGCCGGCCACGAGG - Intronic
1187238158 X:17487642-17487664 GAAGGGCAAGACCAGCTCAGAGG + Intronic
1187281433 X:17860922-17860944 GGAGGCCGGGGCCGGCTGGGAGG - Intronic
1195082714 X:101386313-101386335 GAAGGGCGGGGACAGTTGAGGGG - Intronic
1196717559 X:118825393-118825415 GGAGGGTGGTGCCAGCCCAAGGG + Exonic
1197766423 X:130062033-130062055 GGAGGGCAGGCCCAGAGCAGTGG + Intergenic
1198175539 X:134150911-134150933 GGAGGGAGGGGTGAGATCAGTGG - Intergenic
1198254843 X:134915452-134915474 GGAGGGGAGGGGCAGATCAGAGG - Intergenic
1199743511 X:150757445-150757467 GGGTGGCAGGGCCAACTCAGAGG - Intronic
1200066998 X:153508672-153508694 GGAGAGCAGGGGCAGCTCTGAGG - Exonic