ID: 1037828910

View in Genome Browser
Species Human (GRCh38)
Location 8:22176938-22176960
Sequence CTGGAGGGCGGGGCCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 410}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828910_1037828917 -6 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828917 8:22176955-22176977 CTCCAGGTGCTGCTCCTACGTGG 0: 1
1: 0
2: 0
3: 20
4: 151
1037828910_1037828925 10 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828910_1037828918 -5 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828918 8:22176956-22176978 TCCAGGTGCTGCTCCTACGTGGG 0: 1
1: 0
2: 1
3: 12
4: 102
1037828910_1037828926 18 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828926 8:22176979-22177001 TCGCCGCGGCGGGGGCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218
1037828910_1037828924 9 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1037828910_1037828923 8 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828910_1037828921 7 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828910_1037828920 4 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828920 8:22176965-22176987 TGCTCCTACGTGGGTCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828910 Original CRISPR CTGGAGGGCGGGGCCAGCTC AGG (reversed) Intronic
900149890 1:1173771-1173793 CTGAGTGGCGGGGCCAGCCCGGG - Intergenic
900186906 1:1336959-1336981 CTGGAGGGCGTGGCTGGCTGGGG + Intronic
900560269 1:3301737-3301759 CTGGATGTCTGGGCCAGCTTGGG - Intronic
900625819 1:3608065-3608087 CTGGAGGGCGGGGCTCGCTCAGG + Intronic
900767448 1:4514629-4514651 GTGGAGGGCAGGGCTATCTCAGG - Intergenic
900767523 1:4515104-4515126 GTAGAGGGCGGGGCTATCTCAGG - Intergenic
900767532 1:4515147-4515169 GTAGAGGGCGGGGCTATCTCAGG - Intergenic
900767541 1:4515190-4515212 GTAGAGGGCGGGGCTATCTCAGG - Intergenic
901242772 1:7704645-7704667 CTGGGGGGCGGGGTCTGGTCCGG + Intronic
901525967 1:9823693-9823715 CGGGCGGCCGGGGCCAGCGCGGG + Exonic
901529303 1:9843415-9843437 CTGGCTGGAGGGGCCACCTCAGG + Intergenic
903413801 1:23168184-23168206 CCGGCGTGCGGGGCCAGCTGCGG - Intronic
904277886 1:29396095-29396117 CTGGAGGCTGGAGACAGCTCTGG - Intergenic
904379526 1:30101640-30101662 CTTGTGGGCGGGGCCAGCCTGGG - Intergenic
905174138 1:36125526-36125548 CTGCAGGGAAGGGGCAGCTCGGG + Intergenic
905913685 1:41670929-41670951 CTGGAGTGTGGGGCCTGCTCAGG + Intronic
906559917 1:46748840-46748862 CTGGAGGGGCAGGCCAGCCCAGG - Intergenic
907248677 1:53123601-53123623 CCGGAGGGCTGGCCCTGCTCTGG - Intronic
907306890 1:53518190-53518212 CTCGAGGACAGGGCCAGCACCGG + Intronic
908796158 1:67833153-67833175 CTGGAGGGCGGGGACTGGTCTGG - Intronic
909094557 1:71271111-71271133 CTGGAGGGTGGGGCCCTCTCTGG + Intergenic
912433720 1:109643793-109643815 CTGCGGGGCTGGGCCAGCGCGGG + Intergenic
912935701 1:114002198-114002220 CTTGAGGCCGAGGCCACCTCTGG - Intergenic
912977882 1:114346321-114346343 AAGGAGGGCCGGGCCAGCCCAGG + Intergenic
913186701 1:116374961-116374983 GTGGAGGGCTGGTCCAGGTCAGG + Intronic
913465702 1:119140555-119140577 CTGGAGAGCGGGAGCAGCTGCGG + Exonic
915473446 1:156138950-156138972 CTGGAGGGCAGGGGCAGGGCTGG + Intronic
916720810 1:167483704-167483726 CTGCAGGGCAGTGCCTGCTCTGG + Intronic
916894864 1:169151662-169151684 CTTGAGGGCTGTGCCAGCCCAGG + Intronic
917930426 1:179818883-179818905 GTGGAGAGAGGGGCCAGCTGGGG - Intergenic
917930724 1:179820819-179820841 GTGGAGAGAGGGGCCAGCTGGGG + Intergenic
918150496 1:181794410-181794432 CTGCAGGGCAGGGCCTTCTCTGG + Intronic
920494507 1:206445200-206445222 ATTGAGGGCTGGGCCAGCTCTGG - Intronic
921753544 1:218825631-218825653 CTGGAGGGCAGGCCCAGGTCTGG - Intergenic
922499060 1:226083563-226083585 CCGGTGGGCGTGGCGAGCTCCGG - Intergenic
922570993 1:226634653-226634675 AGGGAGGGCGTGGGCAGCTCAGG + Exonic
922773895 1:228206315-228206337 CTGCATGGCTGGGGCAGCTCAGG + Intronic
1062769090 10:85609-85631 CTGGAGCCCTGGCCCAGCTCTGG + Intergenic
1062835913 10:635621-635643 CAGGAGGCCGTGGCCAGCCCTGG + Intronic
1062835922 10:635640-635662 CTGGAGGAGGGGCCCAGCTGCGG + Intronic
1063022779 10:2146350-2146372 CTGTCGTGCGGGCCCAGCTCAGG + Intergenic
1063420158 10:5906219-5906241 CTGGAGGGCGGGGCAGACCCTGG - Exonic
1063587868 10:7369116-7369138 CTGGAGTTCGAGGCCAACTCAGG + Intronic
1064336728 10:14450174-14450196 ATGGTGGGCAGGGCCAGCCCTGG - Intronic
1065844893 10:29736145-29736167 CTGGGGCGTGGGGACAGCTCTGG - Intronic
1067295429 10:44972880-44972902 CTGGATGCCTGGGCTAGCTCTGG - Intronic
1068792300 10:61040880-61040902 GTGGGGGGCGGGGGGAGCTCAGG - Intergenic
1070520448 10:77248358-77248380 CTGGAGGGGAGGGGCAGCTCTGG + Intronic
1070793804 10:79205299-79205321 GTGGAGGGAGGGGCCAGGGCAGG - Intronic
1070795080 10:79211646-79211668 CGGGATGGCAGGGCCAGGTCTGG - Intronic
1070803406 10:79256421-79256443 CAGGAGGGAGGGGGCTGCTCTGG - Intronic
1071154486 10:82673187-82673209 GTGCAAGGCGGGGCCAGCCCTGG - Intronic
1072312376 10:94168953-94168975 CTGGAGGGGGAGGCCATCTAGGG + Intronic
1073438205 10:103535275-103535297 CTAGAGGGCTAGCCCAGCTCTGG + Intronic
1075119310 10:119652161-119652183 CTAGAGCGCGAGGCCAGCGCTGG - Intronic
1075351111 10:121725996-121726018 ATGGATGGCGGGGCCAGGGCAGG + Intergenic
1076047177 10:127303648-127303670 CTGGAGTGCAAGGCCAGCTTGGG + Intronic
1076115139 10:127890310-127890332 CTGGAGGGTGCGGGCAGCTCAGG - Intronic
1076215101 10:128687058-128687080 CTTGAGGGCGGTTCCAGCTCTGG - Intergenic
1076569994 10:131426251-131426273 CTGGAAGGAGGGGCCAGGGCAGG + Intergenic
1076850596 10:133090656-133090678 CTGGAGGCCGTGGCCAGGGCAGG + Intronic
1076858263 10:133127893-133127915 CTGGTGGGCGTGGCCAGCGTGGG - Intronic
1076904871 10:133356739-133356761 CTAGAGGGAGGGGTCAGCTCTGG + Intronic
1077074481 11:694240-694262 GTGCAGGGCAGGGCCAGGTCAGG + Intronic
1077144667 11:1039626-1039648 ATAGAGGGCGGGGCCAGCGCTGG - Intergenic
1077411817 11:2407193-2407215 ATGAAGGGCGGGGCCAGGGCGGG + Exonic
1077877646 11:6321043-6321065 CTGGCGGGCGGGGCATCCTCTGG + Intergenic
1077976257 11:7251844-7251866 CCGGGGGGCGGGGCCAGGTCAGG - Intronic
1078358095 11:10647754-10647776 CTGGAGCCTGGGGCCAGGTCTGG + Intronic
1078551238 11:12281753-12281775 CTGGAGGGTGGCACCAGCACTGG - Intronic
1081529646 11:43949190-43949212 TTGGAGGGGGGTGCCAGCCCAGG - Intergenic
1081596655 11:44463979-44464001 CTCCAGGGTGGGGCCAGCACAGG + Intergenic
1082803406 11:57431028-57431050 CTGGAGGGTGGGGGCCACTCTGG + Intergenic
1082814600 11:57499718-57499740 CTGAGGGGCGGTGCCAGCGCCGG + Intronic
1083299088 11:61730897-61730919 CTGGAGGGCTGGGGCCTCTCAGG + Intronic
1083728289 11:64639875-64639897 CTGGAGGACCAGGCCAGCTCAGG - Intronic
1083852288 11:65375455-65375477 GAGGAGAGCGGGGCCAGCCCCGG + Exonic
1083858768 11:65407941-65407963 GAGGAGGGCGGGCCCAGCTGTGG + Intronic
1083888670 11:65585109-65585131 CTGGAGGGCGGCGGCGGCGCCGG + Exonic
1083945100 11:65919172-65919194 CTCGGGGGCGGGGCCATCGCGGG + Intergenic
1084012996 11:66363064-66363086 GTGGGAGGCGGGGCCAGCCCAGG - Exonic
1084267823 11:68013995-68014017 CTTGAGGGCGGGACCTGCTCCGG - Intronic
1084487907 11:69461768-69461790 GGGGAGGGCTGGGCCGGCTCAGG - Intergenic
1088883124 11:113987113-113987135 CTGGAGGGCGTGGCCTGCCAAGG + Intronic
1089343250 11:117773845-117773867 CTGGAGGGCTGGGCCAGGAGAGG + Intronic
1089500612 11:118929423-118929445 CTGGAGGGCGGGGGCAGGGCGGG + Intronic
1089583191 11:119494407-119494429 CTGGAGAGCAGGGGCAGCACAGG - Intergenic
1089611804 11:119673405-119673427 CAGGAGGGCCGGGCCACCTAGGG - Intronic
1089696435 11:120218864-120218886 CTGGAGAGTGGGGCCAGCTAGGG + Intronic
1090031607 11:123211267-123211289 CTGGGGGGCGGGTAAAGCTCTGG + Intergenic
1090207091 11:124891400-124891422 CTGGAGAGCTGGGCCAGCTGGGG + Exonic
1091165564 11:133472897-133472919 CTGGAGGGCTGGGACAGGACTGG - Intronic
1091815227 12:3432570-3432592 CTGGAGGGAGGAGACAGCTCAGG + Intronic
1092186537 12:6483757-6483779 GTGGAGGGCGGGGGCAGGTTTGG + Intergenic
1094500366 12:31015888-31015910 CTGGAAGGCAGGGGCAGTTCTGG - Intergenic
1096148104 12:49293199-49293221 CTGGAGGGTGGGGCCAAATCCGG + Intergenic
1096181642 12:49554474-49554496 CTGAAGCGCGGGGCAAACTCGGG - Exonic
1096191586 12:49623493-49623515 CGGGAGGGCGGGGCCGGCGGGGG - Exonic
1096968372 12:55646701-55646723 CTGGAGGACGGGGCCAGAGGAGG + Intergenic
1102084387 12:110124266-110124288 CTGGGGGGCGGGGCCGGGCCAGG - Intergenic
1102395766 12:112584551-112584573 CTGGAGGGGTGGGGCACCTCAGG + Intronic
1103009621 12:117448228-117448250 CTTGAGGGTGGGGCCACCTCTGG + Intronic
1103534735 12:121626749-121626771 CTCGGGGGCGGGGCGGGCTCCGG - Exonic
1103720836 12:122974631-122974653 CGGGAGGGCGGGGTCAGGTGTGG - Exonic
1103937317 12:124483489-124483511 GTGCAGGGAGGGGGCAGCTCGGG - Intronic
1104842261 12:131830746-131830768 CTGGAGGGGAGGGCCCGCCCCGG + Intronic
1104898339 12:132175163-132175185 CTGCAGGGCTGGCCGAGCTCAGG + Intergenic
1105579097 13:21676870-21676892 CTAGGGGGCGGTGCCAGCTTTGG + Intronic
1105591496 13:21796811-21796833 CAGGATGGCAGGGCCAGGTCTGG - Intergenic
1105927031 13:25018095-25018117 CTGTTGGGCGGGGCCGGCTAAGG - Intergenic
1106072223 13:26423912-26423934 CTGCAGGGCGGACTCAGCTCTGG - Intergenic
1106592993 13:31113735-31113757 CTGCAGGACGGGGTCAGATCGGG - Intergenic
1106827742 13:33542662-33542684 CGTGAGGGCGGGGCCAGAACCGG - Intergenic
1107692817 13:42969043-42969065 AGGGAGGGCGGGGCCACCTATGG - Intronic
1108519532 13:51233972-51233994 CTGTAGGGCAGGGGCAGCCCAGG - Intronic
1111562053 13:89964706-89964728 CAGGAGGTCGAGACCAGCTCAGG - Intergenic
1112489331 13:99847920-99847942 CTGAAGGGCAGGGGCAGCCCAGG - Intronic
1113531579 13:111031524-111031546 CTGTAGGCCCAGGCCAGCTCTGG + Intergenic
1113660733 13:112105003-112105025 CTGGGGGGCGGGGAGCGCTCGGG + Intergenic
1114637389 14:24195579-24195601 CTGGAGGCCCGGCCCAGCTCCGG + Intronic
1115788929 14:36857239-36857261 CTGGAGGGCAGGCCCAACACTGG + Intronic
1118206468 14:63727988-63728010 CAGGAGCGCGGGGACAGTTCGGG - Exonic
1118882666 14:69842575-69842597 CTGGAGGGAGGGGACAGTGCTGG - Intergenic
1120712530 14:87807596-87807618 CTGGAGGTCAGGCTCAGCTCTGG - Intergenic
1121358192 14:93232301-93232323 CTGCAGGGCAGGGCCAGGGCAGG - Intergenic
1121491028 14:94361398-94361420 CTGGGGGGCGGGGCTCGGTCAGG - Intergenic
1121492419 14:94369879-94369901 CTGGGGGGCGGGGCTCGGTCGGG - Intergenic
1122152084 14:99730877-99730899 CTAGAGGGCTGGGCCAGCTCAGG - Intergenic
1122228296 14:100292290-100292312 CTGGAGGGCTGCGCCAGGGCAGG + Exonic
1122483646 14:102063858-102063880 GTGGAGGGTGGGGACAGGTCTGG - Intergenic
1122687941 14:103518835-103518857 CTGAGGGGCTCGGCCAGCTCAGG - Intergenic
1122773633 14:104107818-104107840 GTGGGGGGCGGGGCCAGCACTGG + Intronic
1122848967 14:104516424-104516446 GTGGAGTGCGGGACCAGCACTGG - Intronic
1122961322 14:105094738-105094760 CTGGAGGGAGGGGCCTGGGCTGG + Intergenic
1123011368 14:105351049-105351071 CGGGAGCCCGGGGCCAGCCCAGG - Intronic
1123061960 14:105598495-105598517 CTGGTGGGCGGGGCCGGGCCGGG - Intergenic
1123071360 14:105644040-105644062 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123076320 14:105669083-105669105 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123086704 14:105720226-105720248 CTGGTGGGCGGGGCCGGGCCGGG - Intergenic
1123091020 14:105742313-105742335 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123096654 14:105770077-105770099 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123096701 14:105770265-105770287 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123096747 14:105770453-105770475 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123096794 14:105770641-105770663 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1124458996 15:29871610-29871632 CTGGGTGGCCGGGCCAGCTGGGG - Intronic
1125508660 15:40281619-40281641 CCGGAGGGCGGCCCCGGCTCTGG - Exonic
1125674352 15:41494425-41494447 CGCGGGGGCGGGGCCAGCGCCGG + Intronic
1125685007 15:41558927-41558949 CGGGGGGGCGGTGCGAGCTCGGG + Intronic
1125723120 15:41854546-41854568 CTGGGGGACCGGGTCAGCTCAGG + Intronic
1128244004 15:66120510-66120532 ATGGAGGGCCAGGCCAGCTTGGG + Intronic
1128522109 15:68382323-68382345 CTGGTGGCCCGGCCCAGCTCCGG - Intronic
1129392300 15:75226488-75226510 CTTCAGGGCGGCGCCAGCCCAGG - Intergenic
1129413499 15:75362270-75362292 CGGGAGGGCGGGGCTACCTGAGG + Intronic
1129718373 15:77864758-77864780 CTGGAGGGCAGGGCCCGGGCAGG + Intergenic
1130088381 15:80797695-80797717 CTGGATGGAGGGGCCAGCTTGGG + Intronic
1130460550 15:84156107-84156129 CTGGAGGGCAGGGCCCGGGCAGG - Intergenic
1132668073 16:1090936-1090958 CTGCAGGGTGGGGCCAGCCGAGG - Intronic
1132670418 16:1100204-1100226 CTGGCGGGCGGAGCCTGCACGGG - Intergenic
1132844203 16:1992471-1992493 CGGGTGGGCGGGGTCAGCGCAGG + Intronic
1132890186 16:2199921-2199943 CTGAGGGCAGGGGCCAGCTCTGG - Intergenic
1133221287 16:4320204-4320226 CTGGAGGAAGGGGCCAGGGCTGG - Intronic
1133231577 16:4369508-4369530 CTGAGGGGCGGGGGCAGATCTGG - Intronic
1133292880 16:4734432-4734454 CTGGAGGGCGGGGACGGAGCAGG - Exonic
1133328682 16:4958057-4958079 TTGGAGGGCGGGGCCAGTGAAGG + Intronic
1133738729 16:8635240-8635262 CTGGAGCTCGGGGCCGGCACGGG + Exonic
1134058227 16:11183238-11183260 CCGGAGGGCGGGGCCAGCAAGGG + Intergenic
1134069556 16:11252409-11252431 AGGGAGGAAGGGGCCAGCTCTGG + Intronic
1134249669 16:12565669-12565691 CTGGAAGGCAGGGTTAGCTCGGG - Intronic
1135040749 16:19115050-19115072 CGGAAGGCCGGGGCCAGCGCTGG - Exonic
1136296672 16:29307932-29307954 GTGGAGGGCGCGGCCAGCCTTGG + Intergenic
1137558814 16:49490047-49490069 CTGGTGGCGGGGGCCAGGTCTGG - Exonic
1138659529 16:58509108-58509130 CTGGAGTGAGGGCCCTGCTCAGG + Intronic
1138660157 16:58511954-58511976 CAGGGGTGCGGGGCCAGCTCAGG + Exonic
1139329606 16:66177044-66177066 CCAGAGGGCTGGCCCAGCTCCGG + Intergenic
1141538616 16:84700402-84700424 CTGGACCGCGGGGCGAGCCCGGG + Intronic
1141575850 16:84963242-84963264 CTGGATGTCGGGGGCAGTTCTGG - Intergenic
1141619506 16:85229274-85229296 CGGCAGGCCGGAGCCAGCTCTGG + Intergenic
1141639544 16:85333375-85333397 CTGGTGGGCTGGGCCAGCACGGG - Intergenic
1142171947 16:88627561-88627583 CTGGAGGGAGGGGCCAGCAGGGG - Intronic
1142199207 16:88753185-88753207 CTGGGGGGCGGGGTGTGCTCTGG - Intronic
1142441173 16:90098422-90098444 CTGGAGAGCAGGGCTGGCTCAGG + Intergenic
1142756968 17:2022358-2022380 CAGGAGTTCGAGGCCAGCTCGGG - Intronic
1142880418 17:2879018-2879040 CTGGAGGGTGTGGCAAGGTCAGG + Intronic
1143203449 17:5127601-5127623 CTGGAGGAAGGGCCCAGTTCAGG - Exonic
1143270018 17:5668525-5668547 GTGTAGGGCAGGGCCAGCCCTGG - Intergenic
1143328932 17:6120113-6120135 GTGGTGGGTGGGGGCAGCTCTGG - Intronic
1143369250 17:6428274-6428296 CTGGAGGGCTGTGCCAGCACTGG - Intronic
1143369492 17:6429531-6429553 CTGCAGGGAGGGGCCACCTTTGG + Intronic
1143524220 17:7462990-7463012 CTGGTGGGGAGGACCAGCTCTGG - Exonic
1143781121 17:9230312-9230334 CTGGACAGGGGGGCAAGCTCGGG - Intronic
1143891301 17:10104511-10104533 CTGGAGAGCTGGGACAGGTCAGG - Intronic
1143917531 17:10304955-10304977 CTGCAGAGCAGGGCCAACTCTGG + Intronic
1144608632 17:16689690-16689712 CTGGAGCCAGGGACCAGCTCTGG - Intergenic
1144739819 17:17575596-17575618 CAGGAGGCTGGGGCCAGCTGGGG + Intronic
1144772351 17:17766860-17766882 ATGGTGGCAGGGGCCAGCTCAGG + Intronic
1145128407 17:20320605-20320627 CTGGAGCCAGGGACCAGCTCTGG - Intergenic
1146008380 17:29176673-29176695 CTGGAGCACGGGGCCAGGCCAGG - Intronic
1146488925 17:33265949-33265971 CTGAGGAGTGGGGCCAGCTCAGG - Intronic
1146650299 17:34602271-34602293 CTTGCGGGCTGGGCCAGCCCAGG - Intronic
1147683963 17:42276166-42276188 CTGGAGCGCGGGCCCCGCCCGGG + Intronic
1147741859 17:42674558-42674580 CTGGCGGGAGGGGCGAGCCCAGG - Intronic
1148740411 17:49889695-49889717 CGGGAGGGCGGGTACAGCACAGG + Intergenic
1148847953 17:50540280-50540302 GTGGAGGGCGGGGCCAGGGCAGG - Exonic
1149571265 17:57674050-57674072 CTGGAGGCTGGGGCCAGAGCTGG - Intronic
1149599651 17:57885278-57885300 CTGGAGGGCGGTGGCAGCAGCGG - Exonic
1149783930 17:59419958-59419980 CAGGAGGTCGAGGCCAGCTTGGG - Intergenic
1149990942 17:61383223-61383245 CTGTAGGGCCGGGCCAGGCCAGG + Intronic
1150484916 17:65536992-65537014 CTGGCGGGCAGGGCCAGGCCCGG + Exonic
1150820085 17:68427802-68427824 GTGGGGGGCGGTGGCAGCTCTGG + Intronic
1151352790 17:73541576-73541598 AGGGAGGGTGGGGCGAGCTCTGG - Intronic
1151535607 17:74737318-74737340 CTGCAGGGCGGGGAGCGCTCGGG - Intronic
1151551820 17:74826729-74826751 CAGGAAGGATGGGCCAGCTCAGG + Intronic
1151660717 17:75516646-75516668 CGGGGGCGCGGGGCCAGCGCGGG + Intronic
1151962781 17:77415888-77415910 CTGGAGAGCAGGGCCGGCTGGGG + Intronic
1152518927 17:80844041-80844063 CTGCACGCAGGGGCCAGCTCAGG + Intronic
1152594045 17:81229575-81229597 CCAGAGGGCAGGGCCACCTCTGG + Intronic
1152759312 17:82099668-82099690 CAGCAGTGCGGGGCCAGCCCCGG - Intergenic
1153138726 18:1947401-1947423 CTTGAGTGCTGGGCTAGCTCTGG + Intergenic
1153948165 18:10035081-10035103 CTAGAGGGTGGGGCCAGGTGTGG + Intergenic
1154313656 18:13286579-13286601 CAGGAGGTCGAGGCCAGCCCGGG - Intronic
1156496832 18:37531233-37531255 CTGGAGGGGGGCCCCAGCTGAGG - Intronic
1157325945 18:46668974-46668996 CAGGAGAGCGGGGCAAGCTGGGG - Intronic
1160383485 18:78478728-78478750 CTGGAGGGCGGGCAGAGCTGGGG - Intergenic
1160517463 18:79486536-79486558 CTGGACGGCGGGGGCCTCTCCGG - Exonic
1160714985 19:572502-572524 CTCGGGGGCGGGGCGAGCGCCGG - Intronic
1160777612 19:863128-863150 CTCGAGGGCGTGGTCACCTCGGG + Exonic
1160790656 19:921811-921833 CTTAGGGGCGGGGCCAGCGCCGG - Intergenic
1160847107 19:1171521-1171543 CTGGGGGGTGGGATCAGCTCTGG - Intronic
1160943907 19:1632381-1632403 CTTGAGGACCGGCCCAGCTCAGG - Exonic
1161015284 19:1980091-1980113 GTGCAGGGCGGGGGCAGCCCAGG - Intronic
1161245529 19:3249625-3249647 GTGAGGGGCGGGGCCAGCCCCGG - Intronic
1161273930 19:3404920-3404942 GGGGAGGGCGAGGCCAGCACTGG + Intronic
1161313212 19:3606439-3606461 CAGCAGGGCAGGGCCAGCGCCGG + Intronic
1161682515 19:5687195-5687217 CCAGAGGGCGGGGCCAGGGCCGG - Intronic
1161982195 19:7635904-7635926 CTGGAGGGTGGGGGCAGCAGGGG - Intronic
1162046672 19:8005153-8005175 CGGGAGAGTGGGGCCAGCTACGG - Intronic
1162304015 19:9860579-9860601 CTGGAGGGCGGGGTGAGAACTGG + Intronic
1162951108 19:14072654-14072676 CCCGAGGGCGGGGCCAGGGCGGG + Intronic
1163399499 19:17083532-17083554 CTGGAGGGCAGAGTCAGCTCTGG + Intronic
1163435437 19:17292534-17292556 CCGGTGGGCGGGGCCAGGTCAGG - Exonic
1164624117 19:29715254-29715276 ACGGAGGGCGGGGCCAGCGCCGG - Intronic
1165080477 19:33303389-33303411 CTGGACGCCGGGGCGAGCACGGG + Intergenic
1165395996 19:35563787-35563809 GGGGAGGGGGGGGCCAGCCCAGG - Intergenic
1165448223 19:35868479-35868501 CAGGAAGGCGGGGCCGGCGCGGG + Exonic
1165768020 19:38362705-38362727 CTGGAAGGCGGTGCCTGCTCCGG - Exonic
1166214670 19:41327521-41327543 CTGCTGGGGGAGGCCAGCTCAGG - Intronic
1166288082 19:41844717-41844739 CTGGGGGGCGGGGCCAGCCTCGG + Intergenic
1166340333 19:42133273-42133295 CCGGAGGGCGGGGCCGGCTGCGG + Intronic
1167114371 19:47480233-47480255 CTAGAGGGCGGGGCCAGGGTGGG - Intronic
1167393131 19:49210294-49210316 ATAAAGGGCGGGGCCAGCGCGGG - Exonic
1167483445 19:49746603-49746625 CTGGCGGGCCGGGGCAGCCCTGG + Exonic
1167527460 19:49993936-49993958 GGGGAGGGCGGGGTCAGCTCTGG - Intronic
1167645363 19:50702694-50702716 GTGGAGGGAGGGGACACCTCTGG + Intronic
1168108841 19:54180790-54180812 TTGGAGGGTGGGGCCGCCTCCGG + Exonic
925277790 2:2662662-2662684 CTGCAGGGCGGAGCCAGCTGTGG + Intergenic
927211942 2:20644452-20644474 CTGGAGCTCGGGACGAGCTCAGG - Intronic
927810160 2:26176018-26176040 CTGGAGGGCAGGGGCTGGTCTGG + Intronic
929220183 2:39455969-39455991 CTGGAGGGCGGGTTAAGCTGTGG + Intergenic
929557136 2:42932429-42932451 TTGCAGGGCAGGCCCAGCTCAGG - Intergenic
934113865 2:88765788-88765810 CTGTTGGGCGGGGCCGGCTAAGG + Intergenic
934795355 2:97094920-97094942 CCGGAGGGCGGGCCCAGTGCGGG + Intergenic
938258471 2:129878303-129878325 CCGGAGGCCGGGGCTACCTCGGG - Intergenic
938395927 2:130947899-130947921 CTGGAGGGAGGGGCCAAATCTGG + Intronic
939267391 2:139891453-139891475 CAGCAGGGCTGGGCCAGCTCAGG + Intergenic
940834921 2:158510686-158510708 CAGGAGGGCTGGGCCAGATTGGG + Intronic
940967461 2:159855715-159855737 CTGGAGGAAGTGGCCAGCACAGG + Intronic
941905977 2:170716388-170716410 CTGGAGGGTGAGCCCAGCGCGGG - Exonic
944495830 2:200306756-200306778 CGGCAGCGCGGGGCGAGCTCCGG + Intronic
946048666 2:216842769-216842791 CTGGAGGGTGGGGCCTGGTTTGG - Intergenic
946176527 2:217925446-217925468 TTGGAGGGCTGGGCAAGCTTAGG - Intronic
946326052 2:218985216-218985238 CTGGCGGGAGGGGGCAGCCCGGG + Exonic
948645439 2:239401118-239401140 CGGGAGGGCGGGGCCCGCAAGGG - Intronic
948728239 2:239947585-239947607 GGGGAGGGCGGGGCTTGCTCTGG - Intronic
949012093 2:241686731-241686753 CTGGAGGGCGTGGACCGCGCCGG - Exonic
1168872934 20:1146432-1146454 GTGGAGGGTGGGGCCAGATTTGG + Intronic
1170353272 20:15465567-15465589 CTTGAGGGGAGCGCCAGCTCAGG + Intronic
1171810470 20:29742139-29742161 CTGGAGGGCGGGGGCGGATGAGG + Intergenic
1172752136 20:37258396-37258418 CTGGCAGGCAGGGCCAGCACTGG + Intronic
1173353435 20:42265538-42265560 CAGGAGAGAGGGGGCAGCTCTGG - Intronic
1173585265 20:44177320-44177342 GTGGAGGGCAGGGCCTGCTCCGG + Intronic
1174369990 20:50080011-50080033 CTGGCTGTTGGGGCCAGCTCAGG - Intergenic
1174395783 20:50246243-50246265 CTGGAGGGAGAGGGCAGCTCAGG - Intergenic
1174454056 20:50637280-50637302 CTGGAGGGGGGCTCCAGCTGAGG - Intronic
1174648668 20:52106145-52106167 CTGCTGGGCGGGGCCGGCGCCGG - Intronic
1175429510 20:58891635-58891657 CGGGAGGGCCGGGGCAGCGCCGG - Intronic
1175893946 20:62327826-62327848 CCGGAGGGAGAGGCCAGATCTGG + Intronic
1176023253 20:62973209-62973231 CATGCGGGCGGTGCCAGCTCTGG + Intergenic
1176140566 20:63543017-63543039 CAGGAGGGTGGGGCCAGTTTGGG - Intronic
1176161766 20:63652172-63652194 CTGAGGGGCGGGGTCAGGTCGGG + Intronic
1176213704 20:63938635-63938657 GTGGGGGGCGGGGCCAGCGCGGG + Intergenic
1176213712 20:63938652-63938674 CGCGGGGGCGGGGCCGGCTCAGG + Intergenic
1178518196 21:33266300-33266322 CTGGTGGGCGGGGCCTGCAGCGG + Intronic
1179627287 21:42655853-42655875 GCAGAGGGCGGGGGCAGCTCAGG - Intronic
1179797410 21:43793425-43793447 CCGGCGGGCGGGGGCAGCGCGGG + Intronic
1179802840 21:43819562-43819584 CTGAAGGCTGAGGCCAGCTCAGG - Intergenic
1180080527 21:45485729-45485751 GTGGAGGGCGGGGAAAGCTCTGG + Intronic
1180149937 21:45942289-45942311 GTGGAGGGCGGAGCCTGCTGGGG + Exonic
1180842307 22:18965097-18965119 GAGCAGGGCGGGGCCAGCCCTGG - Intergenic
1180901261 22:19374963-19374985 TTGGAGGGAGGGGCCCTCTCAGG + Intronic
1180984571 22:19896889-19896911 CTGGAGGGCATGGCCATCCCAGG + Intronic
1181013329 22:20054703-20054725 CTGGAGGGCGGGGGCATCGGAGG + Intronic
1181064459 22:20299044-20299066 CCGGTGGGCGGGGCCTGCTGTGG + Intergenic
1181572332 22:23774323-23774345 CTGGAGCTGGGGGCCAGCTTGGG + Intronic
1182150836 22:28026110-28026132 TTGGAGGGCAGGGCAGGCTCTGG + Intronic
1182555154 22:31125208-31125230 CTGGAGGTTGGGGCCAGATTGGG - Exonic
1182843912 22:33415184-33415206 CTGCAGGGGAGGCCCAGCTCAGG + Intronic
1183149638 22:36028080-36028102 TTGGAAGGTGGGGCGAGCTCGGG - Intronic
1183386661 22:37519145-37519167 GAGGAGGCCGGGGCCGGCTCGGG - Exonic
1183454710 22:37916155-37916177 CTGGTGGGCAGGGGCAGCCCTGG + Intronic
1183484448 22:38081736-38081758 CAGGAGGGAGGGGCCAGGCCCGG + Intronic
1183743086 22:39679032-39679054 CTGGAGGCAGAGGCCAGCCCAGG - Intronic
1183746401 22:39694357-39694379 CTGGAGTTCAGGGCCAGCCCTGG - Intergenic
1183951843 22:41356858-41356880 ATGGAGTCCGTGGCCAGCTCTGG + Intronic
1184245353 22:43232981-43233003 CTGGAGGGGGTGGCCAGCATGGG - Intronic
1184481799 22:44752531-44752553 CGGGGGGGCGGGGCCTGCCCGGG + Intronic
1184718844 22:46297266-46297288 CTGAAGGCCGCGGCCAGGTCTGG - Intronic
1185065333 22:48629167-48629189 CTTGAGGGCTGGGCCTGCTGGGG + Intronic
1185241579 22:49750152-49750174 CTGGGGGTCGGGGCCTGCTCTGG - Intergenic
1185399427 22:50608286-50608308 CCAGACTGCGGGGCCAGCTCTGG + Intronic
1185399444 22:50608343-50608365 CCAGACAGCGGGGCCAGCTCTGG + Intronic
1185399489 22:50608509-50608531 CCAGACAGCGGGGCCAGCTCTGG + Intronic
1185399565 22:50608784-50608806 CCAGACGGTGGGGCCAGCTCTGG + Intronic
1185418299 22:50721536-50721558 ATGGGGGCCGGGGCCAACTCCGG - Intergenic
950138410 3:10599311-10599333 CAGGAGGGCGAGGCCAATTCTGG - Intronic
950207091 3:11089074-11089096 CTTGAAGACGGGGGCAGCTCTGG - Intergenic
950660418 3:14463696-14463718 GTGGAGGGCGGGGGCACATCAGG - Intronic
954779316 3:53046919-53046941 CAGGAGGAGGGGGCGAGCTCGGG - Intronic
956420265 3:69080078-69080100 CGGGAGGCCGGGGCCCTCTCCGG - Intronic
958779329 3:98522687-98522709 CTCTAGGGCGGGGCCTGGTCGGG - Intronic
960747681 3:120908177-120908199 CGGGAGGGCGGAGCCTGCTCTGG + Exonic
966812698 3:183861981-183862003 CAGGAGTTCGAGGCCAGCTCAGG - Intronic
966917838 3:184594608-184594630 ATGGAGGGGGTGGCCAGCCCTGG + Intronic
968133649 3:196207537-196207559 CTGGGGGGCGGGGCCAGGCGTGG - Intronic
968286206 3:197510285-197510307 CTGGAGGCCGGCGCCGGCTGCGG + Exonic
968361435 3:198149394-198149416 CTGGAGAGCAGGGCTGGCTCAGG + Intergenic
968401759 4:304558-304580 CTGCAGGGGGGGGGCAGCTGCGG - Intronic
968514300 4:1009874-1009896 CTGGCGGGCGGGGCCGGGACGGG - Intergenic
968640616 4:1712634-1712656 TTGGCGGGCGGGGGCAGCTTTGG + Intergenic
969757354 4:9158622-9158644 TTGTAGGACGGGGCCAGCTGTGG + Intergenic
969835454 4:9836498-9836520 GTGGAGGGAGGGGCCAGCAGAGG + Intronic
971385706 4:26139010-26139032 CCAAAGGGCTGGGCCAGCTCAGG + Intergenic
971950024 4:33332718-33332740 CTGGAAGGATGGGACAGCTCAGG - Intergenic
972356480 4:38283756-38283778 CTGGAGAGTGGGGACAGATCTGG - Intergenic
977686077 4:99848859-99848881 TTCGAGGGCCGGGCCAGGTCTGG + Intronic
982268540 4:153563558-153563580 CAGGAGGACGGGTCGAGCTCAGG - Intronic
983945172 4:173578062-173578084 TTGGAGGGAAGGTCCAGCTCTGG - Intergenic
985395269 4:189537084-189537106 GTGTAGGGCAGGGCCACCTCTGG + Intergenic
985634429 5:1028831-1028853 CAGGAGGGCGAGGCCAGGTGGGG + Intronic
985791398 5:1930515-1930537 CTGCACAGCGGGGCCAGCACAGG - Intergenic
986731291 5:10636733-10636755 CTGGATGGAGGTGGCAGCTCAGG + Intronic
987340652 5:16936316-16936338 CGGGAGGGCGGGGCCGGCTGCGG - Intergenic
987340661 5:16936336-16936358 CGGGAGGGCGGGGCCGGCTGCGG - Intergenic
988263996 5:28927649-28927671 CTGTTGGGCGGGGCCGGCTAAGG - Intergenic
990346821 5:54879907-54879929 CTGGAGTGAGGGGGAAGCTCTGG + Intergenic
992215286 5:74519309-74519331 CTGGGGGGCGGGGCAAGGACAGG - Intergenic
993127185 5:83850123-83850145 CTGGAGGGTAGGGCCAAATCAGG - Intergenic
996567877 5:124900522-124900544 CTGGTGGCTGGGGCCATCTCTGG + Intergenic
996967567 5:129323001-129323023 CTGGAGGGTGGTGCCAGGCCAGG + Intergenic
998352209 5:141508970-141508992 CTGGGGGTGGGGGCCAGCTGGGG + Intronic
998393501 5:141803223-141803245 CTGAAGGGCTGGGACAGCCCTGG - Intergenic
1002070404 5:176676032-176676054 CTGGAGTTCGAGGCCAGCCCGGG + Intergenic
1002194930 5:177496573-177496595 CAGGCAGGCCGGGCCAGCTCAGG + Intronic
1002304682 5:178276194-178276216 CAGGAGGACAGGGCCAGCCCTGG - Intronic
1002312486 5:178323206-178323228 CTGGAGGGCAGGGCCCTCGCTGG + Intronic
1002415656 5:179119644-179119666 GTGGGGGGCTGGGCCAGCCCCGG - Intronic
1002636887 5:180613011-180613033 ATGGCGGGAGTGGCCAGCTCCGG + Exonic
1002641303 5:180631875-180631897 CTGCAGGGCCGGAGCAGCTCAGG + Intronic
1005385244 6:25279295-25279317 CGGCTGGGCGGGGGCAGCTCCGG - Intronic
1006510041 6:34516650-34516672 CTGGAGGTCGGGGCCAGGCCTGG - Intronic
1007386463 6:41523430-41523452 GTTCAGGGCGTGGCCAGCTCAGG - Intergenic
1007404981 6:41629992-41630014 GAGGAGGGAGGGGCCAGCACGGG + Intergenic
1016814871 6:148294089-148294111 TTGGGTGGCGGGGCCAGCCCAGG - Intronic
1017146776 6:151241273-151241295 CGGGAAGGCGGTGCCTGCTCGGG - Intronic
1017703150 6:157095286-157095308 CTCCAGGGCTGGGCCAGCACCGG - Intronic
1017966441 6:159271026-159271048 CTGGAGCTGGGGACCAGCTCAGG - Intronic
1018087316 6:160314343-160314365 CTGGGGGGCTGGCCCAGCACTGG + Intergenic
1019049262 6:169170501-169170523 CTGGAGGGCGAGGGCAGCCAGGG - Intergenic
1019254255 7:39326-39348 CTGGAGAGCAGGGCTGGCTCAGG - Intergenic
1019275868 7:175288-175310 CGGCAGGGCGGGGCCAGGACAGG + Intergenic
1019286104 7:223940-223962 GTGGAGGGCCGGGCAGGCTCAGG - Intronic
1019314722 7:379182-379204 CTGGAGGACGAGGCCGGCCCGGG + Intergenic
1019643895 7:2118998-2119020 CTGGAGGCTGGGGCGAGCCCAGG - Intronic
1019781014 7:2939719-2939741 CCTGGGGGCGGGGCCAGCGCGGG - Intronic
1019934058 7:4242826-4242848 GTGGAGGGCGGGGGCGGCCCAGG - Intronic
1020013854 7:4820119-4820141 CAGGGGGACGGGGCCAGCTTAGG - Intronic
1020088459 7:5324109-5324131 CTGAAGGGCTGGGCTAGCTGGGG - Intronic
1020098755 7:5382677-5382699 CTCTAGGGTGGGGCCAGGTCTGG - Intronic
1022089283 7:27097012-27097034 CTGGCGGACGTGGCCAGCGCGGG + Intergenic
1023360966 7:39414678-39414700 ATGGAGGGCGGGGCGACCTTGGG - Intronic
1023823768 7:43995088-43995110 CTGGAGGGCCGGGCCAGGGTGGG + Intergenic
1023829506 7:44030635-44030657 CTGCAGCACGAGGCCAGCTCAGG - Intergenic
1025995233 7:66523541-66523563 CAGGAGGGAGGGGCCAGGCCGGG + Intergenic
1029276526 7:99408483-99408505 CTGGAGGGGCGGCCCAGGTCCGG - Intronic
1029460534 7:100691701-100691723 CTTGAGGGCAGGGCCAGGGCGGG - Intergenic
1029464165 7:100714997-100715019 CTGGGGGTCTGGGACAGCTCGGG + Intergenic
1029548355 7:101223080-101223102 CAGGAGGGCAGGGCCAGGTGTGG + Intronic
1029652193 7:101901193-101901215 GGGTAGGGCGGGCCCAGCTCTGG + Intronic
1029739815 7:102484893-102484915 CTGCAGCACGAGGCCAGCTCAGG - Intronic
1029752035 7:102548501-102548523 CTGGAGGGCCGGGCCAGGGTGGG + Intronic
1029757814 7:102584072-102584094 CTGCAGCACGAGGCCAGCTCAGG - Intronic
1029769987 7:102647595-102647617 CTGGAGGGCCGGGCCAGGGTGGG + Intronic
1029775750 7:102683133-102683155 CTGCAGCACGAGGCCAGCTCAGG - Intergenic
1033288737 7:140063245-140063267 CTCGAGGGCGGCGGCAGCGCTGG + Exonic
1033360437 7:140635513-140635535 CTGGAGAGTGGGGCCAGTACAGG - Intronic
1033662061 7:143408891-143408913 GCGGGGGGCGGGGCCAGCGCCGG + Exonic
1034898712 7:154894183-154894205 CTGGAAGGGGAAGCCAGCTCTGG + Intronic
1034964373 7:155382486-155382508 CTGCAGGACGGGGCCAGCCAGGG - Intronic
1034970870 7:155418343-155418365 CTGGAGGGCAGGGCCTTCCCTGG + Intergenic
1035745218 8:1957157-1957179 GTGGAGGGCAGGGCCACCGCCGG + Exonic
1035764949 8:2098449-2098471 GTGCAGGGCAGGGCCCGCTCAGG + Intronic
1035852267 8:2932548-2932570 CTGGAGGTCTGGGGCAGCCCAGG - Intergenic
1036379381 8:8227601-8227623 CCGGAAGGCGGGGCCAGTTAGGG - Intergenic
1037643731 8:20771664-20771686 GGGGAGGGCTGGGCCAGCTCTGG + Intergenic
1037828910 8:22176938-22176960 CTGGAGGGCGGGGCCAGCTCAGG - Intronic
1037961902 8:23103753-23103775 CTGAAGGAAGGGGCCAGCCCCGG - Intronic
1039072545 8:33659948-33659970 TGGGAGGGCTGGGCCAGCCCTGG + Intergenic
1041588357 8:59547196-59547218 CTGGCGGGCGCCGCCAGCCCTGG + Intergenic
1041713005 8:60910265-60910287 CTGGAGGGACGCGCCAGCTGCGG - Intergenic
1043050339 8:75377494-75377516 GTGGAGGGCGGGGACAGCTGCGG - Intergenic
1045897177 8:107233616-107233638 CTGAAGGCAGGGGCCAGATCGGG - Intergenic
1047533586 8:125698997-125699019 CCGGAGGGAGTGGCCAGCCCAGG - Intergenic
1047890612 8:129303989-129304011 CAGGAGAGGTGGGCCAGCTCAGG + Intergenic
1048799655 8:138184240-138184262 CAGGAGGGCTGGGGCACCTCAGG + Intronic
1049201677 8:141343518-141343540 CTGGAGGGCGGGGCCCCCATGGG + Intergenic
1049220922 8:141428415-141428437 CGGGATGGCAGGGCCAACTCTGG + Intronic
1049236328 8:141514200-141514222 CTGGAGGGACAGGCCAGCTGAGG + Intergenic
1049529217 8:143146102-143146124 CGGGAGGGGCGGGCCAGATCAGG - Intergenic
1049583139 8:143421707-143421729 CTGGAGGGCCGGGACAGCCATGG + Intronic
1049721075 8:144115856-144115878 CTGGTGCGCGGGGCCTGCGCCGG + Exonic
1049812201 8:144580615-144580637 GTGGTGGGCGGGGCCAGGTGAGG - Intronic
1049812232 8:144580711-144580733 GTGGTGGGCGGGGCCAGGTTAGG - Intronic
1049814467 8:144591684-144591706 CTGGAGGGCGGGGCTGTGTCAGG + Intronic
1052048335 9:23820820-23820842 CTGCCGGGCGAGGCCGGCTCTGG - Intronic
1052465836 9:28828934-28828956 CTTGAGGGTGGGGCCTTCTCTGG - Intergenic
1054077093 9:60546564-60546586 CTGTTGCGCGGGGCCAGCTAAGG + Intergenic
1056929909 9:90865790-90865812 CTGGAGGGAGGAGACAGCTGAGG - Intronic
1057703143 9:97377981-97378003 CAGGAGTTCGGGGCCAGCTGAGG + Intronic
1057792435 9:98133038-98133060 CTGGAGGACGGTCCCTGCTCGGG + Exonic
1058421517 9:104837259-104837281 CTGGGGAGCTGGCCCAGCTCTGG + Intronic
1058439090 9:104991224-104991246 CCGGCGGGCGGGGCCGGCGCTGG - Intergenic
1060666679 9:125436000-125436022 CTGGAGGCAGCTGCCAGCTCAGG + Intergenic
1060941639 9:127546032-127546054 CTGGAGTGTGGGTCCTGCTCTGG - Intronic
1061089742 9:128420260-128420282 CGGGAGGACGCGCCCAGCTCAGG + Intronic
1062278014 9:135739697-135739719 GAGGAGGGCGGGGGCACCTCAGG - Intronic
1062326623 9:136015469-136015491 CTGGAAGGCGAGGCCAGCCCAGG + Intronic
1062349795 9:136133159-136133181 CTCGGGGGCGGGGCAAGCTTAGG - Intergenic
1062358851 9:136178007-136178029 GTGGAGAGCGGGGACAGCACTGG + Intergenic
1062398711 9:136363227-136363249 CTCGGGGGCGGGGCCTTCTCTGG - Intronic
1062526018 9:136978444-136978466 GTGAGGGGCGGGGCCATCTCCGG + Intronic
1062540324 9:137039181-137039203 GTGTAGGGCTGGGCCAGCCCAGG - Intergenic
1062567129 9:137168335-137168357 GGGGAGGGCAGGGCCAGCCCCGG - Exonic
1062613119 9:137383824-137383846 CTGGAGGGAGGGGGCGGCGCGGG - Intronic
1062653598 9:137590646-137590668 CTGGGGAGCGGGGCGAGCGCGGG + Intergenic
1062746147 9:138213215-138213237 CTGGAGAGCAGGGCTGGCTCAGG + Intergenic
1185504703 X:623844-623866 CTGCAGGACGCGGCCAGCCCCGG - Intergenic
1185611245 X:1394817-1394839 CTGGAGGTTGGGGCCAGCTCTGG + Intergenic
1185729417 X:2449296-2449318 TCGGAGGGCCGGGCCTGCTCAGG + Intronic
1185730812 X:2460223-2460245 TCGGAGGGCCGGGCCTGCTCAGG + Intronic
1185733757 X:2481770-2481792 TCGGAGGGCTGGGCCTGCTCAGG + Intronic
1191781095 X:64866695-64866717 CTGGAGGGCAGGGAGGGCTCTGG + Intergenic
1192183514 X:68930742-68930764 GTGGAGGGCAGGGCCAGGGCTGG + Intergenic
1192554948 X:72081959-72081981 CTGGAGGGAGAGGCCAGCTGTGG - Intergenic
1197771964 X:130094905-130094927 CTTGAGGTTGGTGCCAGCTCAGG + Intronic
1202378700 Y:24259073-24259095 CTGGAGGGCAGGGCCCGGGCAGG + Intergenic
1202492082 Y:25411048-25411070 CTGGAGGGCAGGGCCCGGGCAGG - Intergenic