ID: 1037828912

View in Genome Browser
Species Human (GRCh38)
Location 8:22176948-22176970
Sequence GGAGCAGCACCTGGAGGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 516}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828912_1037828923 -2 Left 1037828912 8:22176948-22176970 CCCCGCCCTCCAGGTGCTGCTCC 0: 1
1: 0
2: 5
3: 67
4: 516
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828912_1037828928 21 Left 1037828912 8:22176948-22176970 CCCCGCCCTCCAGGTGCTGCTCC 0: 1
1: 0
2: 5
3: 67
4: 516
Right 1037828928 8:22176992-22177014 GGCCCCCAGGCCATCTCCATCGG 0: 1
1: 0
2: 2
3: 13
4: 184
1037828912_1037828925 0 Left 1037828912 8:22176948-22176970 CCCCGCCCTCCAGGTGCTGCTCC 0: 1
1: 0
2: 5
3: 67
4: 516
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828912_1037828924 -1 Left 1037828912 8:22176948-22176970 CCCCGCCCTCCAGGTGCTGCTCC 0: 1
1: 0
2: 5
3: 67
4: 516
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1037828912_1037828921 -3 Left 1037828912 8:22176948-22176970 CCCCGCCCTCCAGGTGCTGCTCC 0: 1
1: 0
2: 5
3: 67
4: 516
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828912_1037828920 -6 Left 1037828912 8:22176948-22176970 CCCCGCCCTCCAGGTGCTGCTCC 0: 1
1: 0
2: 5
3: 67
4: 516
Right 1037828920 8:22176965-22176987 TGCTCCTACGTGGGTCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 33
1037828912_1037828926 8 Left 1037828912 8:22176948-22176970 CCCCGCCCTCCAGGTGCTGCTCC 0: 1
1: 0
2: 5
3: 67
4: 516
Right 1037828926 8:22176979-22177001 TCGCCGCGGCGGGGGCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828912 Original CRISPR GGAGCAGCACCTGGAGGGCG GGG (reversed) Exonic
900104237 1:975506-975528 GCAGCAGCCCCTGCAGGGTGGGG - Exonic
900168838 1:1256438-1256460 GGAGGAGCCCCTGGCGGGTGTGG + Intronic
900176984 1:1295331-1295353 GGAGCAGCATCTGAAGGGGCGGG - Intronic
900185275 1:1330490-1330512 GGAGCAGCACCAGGTGTGCAGGG - Intergenic
900211852 1:1460030-1460052 GGAGCAGGACCTCGGGGGCCCGG - Intronic
900296757 1:1955769-1955791 TGAGCAGCAGCTAGAGGGCACGG - Exonic
900323174 1:2095022-2095044 GGAGCAGCACATGGGGGGCTGGG - Intronic
900338838 1:2178211-2178233 GGAGCAGCCACTGCAGGGTGTGG - Intronic
900399375 1:2466756-2466778 GGAGCAGCGCGTGCAGGGGGAGG + Intronic
900583912 1:3423347-3423369 GCAGCAGCACCCGGAAGGTGTGG + Intronic
900661075 1:3784042-3784064 GCAGCTGCAGCTGGAGGCCGAGG - Exonic
900996935 1:6127899-6127921 GGGGCTGCGGCTGGAGGGCGGGG + Intronic
901025869 1:6278452-6278474 GGAGCGGCACTGGGTGGGCGTGG + Intronic
901604729 1:10450235-10450257 GCAGCAGCAGCAGGAGGCCGGGG - Exonic
901909128 1:12440379-12440401 GGAGCAGCAGCTTGAATGCGAGG + Intronic
902231404 1:15029941-15029963 GGAGTGGCTCCTGGAGGGCAGGG - Intronic
902362232 1:15948191-15948213 GGGGCAGCACCTGCAGGCTGTGG - Intronic
902681395 1:18046338-18046360 GGGGCAGCAAGTGGAGGGTGTGG - Intergenic
904042058 1:27590845-27590867 TGAGCATCAGCTGGAGGGAGTGG + Intronic
904360124 1:29965735-29965757 GGAGCAGCCCCAGCAGGGTGGGG + Intergenic
905152359 1:35940799-35940821 GGAGGAGGACCTGGAGAGAGTGG - Intronic
905393196 1:37651149-37651171 GGAGCAGCAGGTGGAAGGGGAGG - Intergenic
905934333 1:41811680-41811702 GGAGCACCACGGGGAGGGGGTGG + Intronic
906839592 1:49122195-49122217 GATGCAGCCCATGGAGGGCGAGG - Intronic
907053519 1:51345115-51345137 GTGGCAGCACCTGGACGGGGCGG + Exonic
909663868 1:78112505-78112527 GGAGCAGCACCTATGGGGCCTGG - Intronic
909764208 1:79334373-79334395 GGAGCAGCAACTTTAGGGCGGGG + Intergenic
910231992 1:84997152-84997174 GGGGCAGCCCCTTGGGGGCGGGG - Intergenic
910508978 1:87982477-87982499 GAAGTACCACCTGGAGGGCGAGG + Intergenic
911025977 1:93435546-93435568 GCAGGTGCACCTGGAGGGCAGGG + Intergenic
914916460 1:151822290-151822312 GGAGCAGGAGCGGGAGGGCTGGG + Intronic
915246302 1:154558490-154558512 GGGGCAGCAGCTGGGGGGCCAGG - Exonic
917519428 1:175735751-175735773 GTAGAAGAACCTGGAGGGAGGGG + Intronic
917671333 1:177276193-177276215 GCAGCAGCACCTGAAGGCCTGGG - Exonic
917869552 1:179229460-179229482 GGAGCAGCGCCAGGAGCCCGAGG - Exonic
918388746 1:184037002-184037024 GGAGCAGCAGCTGCAGGGCGAGG - Intronic
918461076 1:184777312-184777334 GGAGGATCACCTGGAGATCGAGG - Intergenic
919643233 1:200065985-200066007 GGTCCAGCTCCTGGAGGGCTTGG + Intronic
920441361 1:205983056-205983078 GCAGCACCATCTGGAAGGCGTGG + Intronic
921074156 1:211686226-211686248 GGAGCAGCAGCAGGAGAGTGCGG - Intergenic
921583920 1:216926180-216926202 GAAGCAGCAGCTCGAGGGCAGGG - Intronic
922558275 1:226549201-226549223 GTCGCAGCACTTGGAGCGCGCGG - Intronic
922925120 1:229342138-229342160 GGAGCAGGACGCGGAGGCCGGGG - Exonic
923803948 1:237238043-237238065 GGAGGATCATCTGGAGGTCGAGG - Intronic
1062977192 10:1692984-1693006 GGACTAGCACCTGGAGGGTGGGG - Intronic
1063944791 10:11165814-11165836 GGAGCAGCCCCTGGAGCACAGGG - Intronic
1065613930 10:27500927-27500949 GAAGCAGTACCTGGAGAGGGTGG + Intergenic
1065813494 10:29463884-29463906 GGAGGAGGACCTGGAGGACGAGG - Intronic
1065949419 10:30638431-30638453 GAAGCAGTACCTGGAGAGGGTGG - Intergenic
1067434200 10:46265774-46265796 GGAGCGGCCCCTGGAGGGCCTGG + Intergenic
1068044745 10:51871760-51871782 GGTCCAACACCTGGAGGGAGGGG + Intronic
1068186628 10:53593879-53593901 GAAGGAGCTCCTGGAGGGAGGGG - Intergenic
1069683449 10:70301222-70301244 CGAGCAGCACGTGGTGGGTGGGG - Exonic
1070812588 10:79305833-79305855 GGAGCAGCAGGTGGAGGGTCGGG - Intronic
1071458853 10:85872592-85872614 GGGGCAGCACCTGGAGTGAGTGG + Intronic
1072248881 10:93566551-93566573 GGAGCTGCACCCGGGGCGCGCGG - Intergenic
1073469049 10:103711537-103711559 AGAGCTGCACCGGGAGGGCCAGG + Intronic
1075345891 10:121681790-121681812 GGACCAGCACGGGGAGGGAGGGG - Intergenic
1076260984 10:129065960-129065982 AGAGCAGCACCTGGATGAAGCGG - Intergenic
1076719309 10:132386313-132386335 GAGGCAGCAGCTGGAAGGCGGGG + Intergenic
1076799276 10:132813194-132813216 GGCCCAGCACCTGGAGGTCAAGG + Intronic
1077051437 11:568639-568661 GGGGCGGCACCTGCCGGGCGGGG + Intergenic
1077065100 11:637550-637572 GCGGCAGCACCAGGAGAGCGAGG - Exonic
1077103069 11:830674-830696 CGAGCAGGACCTGGAACGCGCGG + Exonic
1077298913 11:1838349-1838371 GGAGCAGGACCAGGAGTGAGGGG - Intergenic
1077324671 11:1958626-1958648 GGAGGAGGATCTGGAGGCCGGGG - Intronic
1077465108 11:2730210-2730232 GCAGCTGGACCAGGAGGGCGAGG + Intronic
1077483269 11:2826523-2826545 GAAGCAGCAGCAGGAGGGGGCGG - Intronic
1077533986 11:3110292-3110314 AGAGCAGCCACTGGAGGGCGAGG + Intronic
1077539190 11:3138700-3138722 GGAGCCTCACCAGGAGGGCCAGG - Intronic
1077713703 11:4559928-4559950 GGGACAGCACCTGGAGGGAGGGG + Intergenic
1078359441 11:10657036-10657058 GTAGCAGCAGGTGGAGGACGCGG + Intronic
1079504103 11:21133855-21133877 GCAGCTGCACCTGGAGGGTGGGG + Intronic
1079882441 11:25944302-25944324 GCAGCTGCAGCTGGAGGGCGGGG - Intergenic
1080346953 11:31335735-31335757 GGACCAGTACCTGGAGGCTGGGG + Intronic
1080428117 11:32174478-32174500 GGACCAGAACCTGGAGGGTGTGG - Intergenic
1081542619 11:44047156-44047178 TCAGAATCACCTGGAGGGCGTGG - Intergenic
1081618335 11:44603636-44603658 TGGGACGCACCTGGAGGGCGAGG - Intronic
1081672094 11:44948190-44948212 GGAGAGGCAGCTGCAGGGCGGGG - Intronic
1081990268 11:47333695-47333717 GGGGCAGCCCCTGGCAGGCGAGG - Exonic
1083203262 11:61132509-61132531 TGAGAAGTTCCTGGAGGGCGAGG - Exonic
1083365775 11:62140746-62140768 GGAGCAGCACCTGGAGGATGAGG + Exonic
1083572550 11:63768346-63768368 GGGGCGCCACCTGGTGGGCGCGG - Intronic
1083635108 11:64116645-64116667 GGTGCAGCTCCCGGAGGGAGCGG - Exonic
1084419943 11:69055365-69055387 GGGGCAGCACGTAGAGGGCCTGG - Intronic
1084685825 11:70694666-70694688 GGAGGAGCATCTGGAGGCCATGG - Intronic
1085011047 11:73142078-73142100 GGAGGAGCACCGGGAAGGCTTGG + Exonic
1085246883 11:75108925-75108947 GGAGCACCATCTTGAGGGAGAGG - Intronic
1085519767 11:77131033-77131055 GGAGCAGTGACTGGAGGGCGGGG + Intronic
1087181847 11:95149888-95149910 GTATCAGCCCCGGGAGGGCGAGG + Intergenic
1088598141 11:111455076-111455098 GGAGCAGCAGCAGGTGGGCTTGG + Exonic
1089184239 11:116604011-116604033 CAGGCAGAACCTGGAGGGCGGGG + Intergenic
1089556127 11:119316809-119316831 GGAGCAGCACTCGGAAGGCGGGG - Intronic
1090788438 11:130069813-130069835 GGAGCCGCAGAAGGAGGGCGTGG + Intergenic
1202807650 11_KI270721v1_random:13803-13825 GGAGGAGGATCTGGAGGCCGGGG - Intergenic
1091409759 12:231479-231501 AAAGCAGCACCTGCAGGGTGGGG - Intronic
1091812357 12:3409945-3409967 GTAGCAGCAACTGGGAGGCGTGG + Intronic
1092202967 12:6598328-6598350 GGATCAGCATCTGGAGGCCGAGG + Exonic
1094135449 12:27120287-27120309 GGTGCAGCCCATGGAGGGCGAGG - Intergenic
1096114722 12:49049157-49049179 GGAGGAGCCCATGGAGGACGTGG - Exonic
1096222667 12:49841794-49841816 AGTCCAGCATCTGGAGGGCGGGG - Intronic
1096243830 12:49973586-49973608 GGAGGGGCACCTGGAGGGCCAGG + Intronic
1097054165 12:56240043-56240065 GGAGCAGCCCCTGGGGGAGGGGG - Exonic
1097791857 12:63823484-63823506 GCAGCAGCAGCTGCAGGACGTGG - Intergenic
1099528796 12:83748917-83748939 TGAGCAGCACCTGGAAGGTAGGG + Intergenic
1100980132 12:100157049-100157071 GCAGCTTCACCTGGAGGGAGGGG + Intergenic
1102767045 12:115442679-115442701 CGGGCAGCACCTGGAAGGCTGGG - Intergenic
1103516207 12:121509923-121509945 GGAGAAGGACGAGGAGGGCGAGG - Exonic
1103604846 12:122078898-122078920 TGAGCAGCACCTGGCGGCCCCGG - Exonic
1103623117 12:122200802-122200824 GGCCCAGCACCTGGAGGATGGGG - Exonic
1103624349 12:122206839-122206861 GGAGCTGCACCTGCAGCGCTGGG + Exonic
1103701982 12:122853030-122853052 GGAGCAGGACCTGAGGGGCCAGG + Intronic
1104188199 12:126452865-126452887 AGAGCAGCACCGGCCGGGCGCGG + Intergenic
1104692152 12:130834432-130834454 GGAGCAGCACCTGCAAGGGCAGG + Intronic
1104768389 12:131345282-131345304 GGATCAGCACCTGCAGCCCGTGG + Intergenic
1104774116 12:131382268-131382290 TCAGCAGCACCAGGAGGGAGTGG - Intergenic
1104774132 12:131382326-131382348 TCAGCAGCACCAGGAGGGAGCGG - Intergenic
1104774163 12:131382439-131382461 TCAGCAGCACCAGGAGGGAGGGG - Intergenic
1104774283 12:131382833-131382855 GGCTCAGCACCAGGAGGGAGCGG - Intergenic
1104774299 12:131382888-131382910 TCAGCAGCACCAGGAGGGAGGGG - Intergenic
1104811655 12:131623306-131623328 GGATCAGCACCTGCAGCCCGTGG - Intergenic
1104947600 12:132423558-132423580 GCAGCGGCCCCGGGAGGGCGGGG + Intergenic
1105546027 13:21351840-21351862 GGAGCAGCATCTGGAGAGGATGG + Intergenic
1105935838 13:25097654-25097676 GCAGCAGCAGCTGCAGGACGTGG - Exonic
1106190751 13:27450451-27450473 GGACCGGCATCGGGAGGGCGTGG - Intronic
1106232310 13:27830146-27830168 GGGGCCGCACCTGCCGGGCGCGG - Intergenic
1106952844 13:34904471-34904493 GGAGAAACACTTGGAGGGTGTGG - Intergenic
1107085931 13:36428026-36428048 GGAACAGCTCCTTGAGGGCAGGG + Intergenic
1107404901 13:40103089-40103111 TGAGCAGTACCTGGAGCCCGTGG - Intergenic
1108002142 13:45913814-45913836 GGAGGATCACCTGGAGGGCCAGG - Intergenic
1108522685 13:51259769-51259791 GGACAAGCACCTTGAGGGCAGGG + Intronic
1109358538 13:61266798-61266820 GGTGCAGCCCATGGAGGGTGAGG + Intergenic
1112023508 13:95392185-95392207 AGAGCAACACATGGAGGGAGTGG - Intergenic
1113318866 13:109213048-109213070 GGAGCTGCACCTGGCAGGAGGGG + Intergenic
1113920811 13:113908328-113908350 AGAGCAGCACCTGCAGGGGCAGG - Intergenic
1113927937 13:113951603-113951625 GGAGCAGGGCATGGGGGGCGGGG - Intergenic
1113958650 13:114113062-114113084 GGGGCAGGAGCTGGAGGGCTGGG + Intronic
1117141117 14:52791704-52791726 GGGGCGGGACCAGGAGGGCGAGG + Intergenic
1117141134 14:52791745-52791767 GGGGCGGGACCAGGAGGGCGAGG + Intergenic
1117790098 14:59331350-59331372 GGAGGGCCACCTGGAGGGAGGGG - Exonic
1117901914 14:60543139-60543161 GGAGCAGCCCATGGAAGGTGTGG + Intergenic
1117992533 14:61448786-61448808 GGAGCAGCCTCTGGAGGGCCTGG + Intronic
1118485427 14:66210212-66210234 GGAGCAGCAAATGCAGGGAGGGG + Intergenic
1118718177 14:68575132-68575154 GGAGCACCATCTGAAGGGCTTGG - Intronic
1118804525 14:69224005-69224027 GGAGCAGCACCAAGACGGCGGGG + Intronic
1118906702 14:70028686-70028708 GAAGCAGCTGCTGGAGGGAGTGG + Intronic
1119155015 14:72402114-72402136 GAGGCAGCACCAGGAGGTCGTGG - Intronic
1119322577 14:73740496-73740518 GGAGCGGAACCAGGAGGGTGAGG - Intronic
1121582354 14:95040293-95040315 GGAGCAGCACAGGGAAGGGGAGG + Intergenic
1121624969 14:95377223-95377245 GGAGCAGAACCCAGAGAGCGTGG + Intergenic
1121656222 14:95597791-95597813 GGAGCAGCCCCTGGAGGCTGCGG - Intergenic
1121685571 14:95832600-95832622 AGAGCAGCAGCTGGAGTGAGAGG - Intergenic
1121820023 14:96958716-96958738 GCAGCAGCACGTGGAGCCCGAGG - Intergenic
1121920323 14:97874864-97874886 GGAACAGAAGCTGGGGGGCGGGG - Intergenic
1122226983 14:100285830-100285852 GCAGCGCCCCCTGGAGGGCGGGG + Intergenic
1122503716 14:102218487-102218509 CGAGCAGCACCTGCAGGGGCAGG + Intronic
1122635422 14:103127441-103127463 GAAGGAGGACCTGGAGGCCGTGG + Exonic
1122701756 14:103594321-103594343 GGAGCTGCAGCTGGAGGACCCGG + Intronic
1122905075 14:104797837-104797859 CCAGCAGCAGCTGCAGGGCGGGG + Intergenic
1122971992 14:105156106-105156128 GCAGCAGCACACGGAGGGCAGGG + Intronic
1123057167 14:105575968-105575990 GGTGCAGCACCCGGACTGCGTGG + Intergenic
1123067967 14:105627764-105627786 GGGGCAGCTCCTGGAGGTCAGGG - Intergenic
1123081077 14:105695923-105695945 GGTGCAGCACCCGGACTGCGTGG - Intergenic
1123091853 14:105745465-105745487 GGAGCAGCTCCTGGAGCTCAGGG - Intergenic
1123194135 14:106600303-106600325 GAAGCTGCACCTGGCGGGGGGGG + Intergenic
1123473705 15:20572306-20572328 GCAGCTTCACCTGGAGGGAGGGG - Intergenic
1123631476 15:22263062-22263084 GGAGCAGGGCCTGGTGGGCAGGG + Intergenic
1123644304 15:22428047-22428069 GCAGCTTCACCTGGAGGGAGGGG + Intergenic
1123665612 15:22607946-22607968 GCAGCTTCACCTGGAGGGAGGGG + Intergenic
1123734005 15:23167317-23167339 GCAGCTTCACCTGGAGGGAGGGG - Intergenic
1124222340 15:27861562-27861584 GGAGGAGTACCTGAAGGGCCAGG + Intronic
1124224703 15:27883107-27883129 AGAGCAGCACCTGCAGGCCAGGG - Intronic
1124284508 15:28388628-28388650 GCAGCTTCACCTGGAGGGAGGGG - Exonic
1124298189 15:28522986-28523008 GCAGCTTCACCTGGAGGGAGGGG + Exonic
1124319437 15:28702360-28702382 GCAGCTTCACCTGGAGGGAGGGG + Exonic
1124483079 15:30093071-30093093 GCAGCTTCACCTGGAGGGAGGGG - Exonic
1124489527 15:30145139-30145161 GCAGCTTCACCTGGAGGGAGGGG - Exonic
1124520504 15:30404147-30404169 GCAGCTTCACCTGGAGGGAGGGG + Exonic
1124538153 15:30562072-30562094 GCAGCTTCACCTGGAGGGAGGGG - Exonic
1124544619 15:30614133-30614155 GCAGCTTCACCTGGAGGGAGGGG - Exonic
1124564574 15:30801562-30801584 GCAGCTTCACCTGGAGGGAGGGG - Intergenic
1124754000 15:32393188-32393210 GCAGCTTCACCTGGAGGGAGGGG + Exonic
1124760500 15:32445513-32445535 GCAGCTTCACCTGGAGGGAGGGG + Exonic
1124778136 15:32603549-32603571 GCAGCTTCACCTGGAGGGAGGGG - Exonic
1125386240 15:39140051-39140073 GGAGCAGCCCCAGGAGGGTAAGG + Intergenic
1125738588 15:41945495-41945517 GGAGCAGCAGGTGGAGGCGGAGG + Intronic
1126436664 15:48644906-48644928 GGAGCAGCGCCTGGAGAAGGCGG - Exonic
1126500660 15:49340429-49340451 GGTGCAGCCCAAGGAGGGCGAGG - Intronic
1126849953 15:52790709-52790731 GAAGCAGCAACTGGAGAGAGAGG - Intronic
1126864752 15:52924760-52924782 GGAGCAGCCCAGGGAGGGTGTGG - Intergenic
1126953743 15:53911206-53911228 GGAGCAGGACCTGGGGGTGGGGG + Intergenic
1127772531 15:62243171-62243193 GCAGCTTCACCTGGAGGGAGGGG + Intergenic
1128237979 15:66080414-66080436 GGAGGGGGACCTGGATGGCGAGG - Intronic
1128735293 15:70050222-70050244 GGAGAAGCAGCAGGAAGGCGTGG + Intronic
1129082502 15:73052767-73052789 GGAGCCGCTCCTGGCGGCCGCGG - Exonic
1129385924 15:75196066-75196088 GGAGCAGCTCCTGCAGCACGGGG + Intronic
1129800660 15:78411549-78411571 GGAGCAGTGCCTGGTGGCCGCGG + Intergenic
1129908850 15:79209406-79209428 GGAGCAGGACCTGCTGGGCTGGG + Intergenic
1130076703 15:80695648-80695670 GCAGCAGCCCGAGGAGGGCGCGG + Exonic
1130133788 15:81164857-81164879 GGAGAAGCAGCTGGATGTCGAGG - Intronic
1131019929 15:89088923-89088945 GGATCCGCACCTGGAAGGAGAGG + Intronic
1131073397 15:89479825-89479847 TGAGGAGCTCCTGGAGGGCAGGG + Intronic
1131085865 15:89575445-89575467 GCAGCAGTTCCTGGAGAGCGCGG + Intergenic
1131108664 15:89750913-89750935 GGCGCAGCTCGTGCAGGGCGCGG + Exonic
1131231835 15:90665424-90665446 TGAGCAGCACCGGAAGGGAGCGG + Intergenic
1131270829 15:90946767-90946789 GGAGGAGCAGCTGGTGGCCGTGG + Exonic
1131431611 15:92393280-92393302 AGATCAGCACCTGGAGGGAGTGG + Intergenic
1132184650 15:99792556-99792578 GCAGCTTCACCTGGAGGGAGGGG - Intergenic
1132460752 16:53405-53427 GGAGCAGCAGTCGGAGGACGCGG + Intronic
1132495459 16:261180-261202 GGAGCAGCACGCGGAGGTGGTGG - Intronic
1132585946 16:705806-705828 GGAGGAGCGCGGGGAGGGCGAGG - Exonic
1132599705 16:768056-768078 GGAGGGGCACATGGAGGGGGGGG + Intronic
1132656173 16:1042898-1042920 GGAGCAGCACCGGGAAGGGGCGG - Intergenic
1132701697 16:1224870-1224892 TGAGCAGGACCTGGAGGGCGGGG - Intronic
1132761493 16:1510600-1510622 GAAGCTGCAGCTGGAGGGCTGGG - Exonic
1132763886 16:1524876-1524898 GGCGCAGTACCTGGAGAGCCAGG - Exonic
1132866084 16:2093367-2093389 GGGGCAGCAAGTGGGGGGCGTGG + Intronic
1132931386 16:2460709-2460731 AGAGCAGCACCTGGAGAAGGCGG - Intronic
1133014049 16:2930720-2930742 GGAGGAGCCCCTGGAGGGGGTGG + Exonic
1133040639 16:3058434-3058456 GGACCGGCAGCTGGAGGGCGGGG + Exonic
1133301207 16:4783903-4783925 GGGGCTGCACCTGCAAGGCGAGG - Intronic
1133771539 16:8869316-8869338 GGAGCCGCACCTGGCGCGCGTGG - Intergenic
1133841978 16:9418234-9418256 GGAGAAGAGCCTGGAGGGAGAGG - Intergenic
1134135971 16:11676502-11676524 GCAGCCTCACCTGGAGGCCGAGG - Exonic
1135325878 16:21525638-21525660 GGAGCAGCGCCTGGAGGCCCAGG + Intergenic
1135693684 16:24567270-24567292 GGAGGAACACCCGGAGGGAGAGG - Exonic
1136234315 16:28904779-28904801 GGAGGAGGCGCTGGAGGGCGGGG + Exonic
1136293631 16:29290071-29290093 GGAGCAGGTCCTGGGGGGTGGGG - Intergenic
1136374764 16:29858956-29858978 GGAGCACCGCCTGGATGGAGGGG + Exonic
1136399521 16:30010086-30010108 GGACCAGGACCTGAAGGGGGCGG - Exonic
1136499150 16:30661052-30661074 GGAGAAGCAGCTGGAAGGAGAGG + Intronic
1136550632 16:30980627-30980649 GGCCCGGCAGCTGGAGGGCGTGG + Exonic
1138035885 16:53605556-53605578 CGAGCAGGACCTGGAGTGTGAGG - Exonic
1138520917 16:57570422-57570444 AAAGCAGCACCAGGAGGGCTGGG - Exonic
1139662130 16:68428451-68428473 GGAGCAGCAGCAGAAGGGCCTGG + Intronic
1140529095 16:75648521-75648543 GGAGGAGGACCCGGAGGCCGCGG + Exonic
1141138544 16:81482450-81482472 GGAGGAGCTCCTGGAGGGGAGGG + Intronic
1141181073 16:81753835-81753857 GGAGAAGCAGCTGGAGGGCTGGG + Intronic
1141971533 16:87487409-87487431 GGAGCAGGGCCTGGTGGGCAGGG - Intronic
1142099513 16:88264077-88264099 GGAGCAGGTCCTGGGGGGTGGGG - Intergenic
1142135361 16:88449509-88449531 GGGGCAGAAGCTGGAGGCCGGGG - Intergenic
1142147447 16:88498516-88498538 GGAGCAGATCCCGGAGGGCCTGG - Intronic
1142188327 16:88705498-88705520 GGAACAGAAACTGGAGGACGTGG - Intronic
1142275940 16:89118974-89118996 CGAGCGGCACCTGGAGTGTGGGG + Intronic
1142419419 16:89961316-89961338 TGAGGAGCACCTGGAGGGCTGGG + Intronic
1142420123 16:89964783-89964805 GGAGCGGCACCTGGGGGATGAGG + Intronic
1142578187 17:923141-923163 GGACCACCACCTGGACGGCGCGG + Intronic
1142791119 17:2266862-2266884 GGAGCAGCCCCTGGTAGGCAAGG - Intronic
1144535652 17:16087417-16087439 GGATCAGCCCCTGGATGGTGTGG - Intronic
1144682681 17:17205944-17205966 GGTGCAGCAACTGCACGGCGCGG + Exonic
1145003605 17:19322379-19322401 GTAGCAGCACTAGGAGGGAGAGG - Intronic
1145197678 17:20908813-20908835 CGAGCAGCAGCAGGAGGGCCTGG - Intergenic
1145296035 17:21593273-21593295 GGAGGAGAAGCTGGAGGGCTAGG + Intergenic
1145938010 17:28726334-28726356 GCAGCAGCGCCTGAGGGGCGGGG - Intronic
1146058376 17:29592326-29592348 GGACCAGTCCCTGGAGGGAGGGG - Intronic
1146563379 17:33890891-33890913 GGAGAATCACCTGGAGAGCTTGG + Intronic
1147036785 17:37687497-37687519 AGAGCAGCAGGTGGAGGGCTGGG + Intronic
1147943477 17:44066503-44066525 GGAGCAGCGGCTGCAGGGCGAGG - Exonic
1148156587 17:45428198-45428220 GGAACGGCACCCGGCGGGCGGGG - Intronic
1148460877 17:47838389-47838411 GGGACAGCACCTGGGGGGCCTGG + Exonic
1149560509 17:57604880-57604902 GGAGGAGCAGCTGGAAGGAGTGG - Intronic
1149886249 17:60342909-60342931 GGTGCAGCCCACGGAGGGCGAGG - Intronic
1150445666 17:65225424-65225446 GGTGCAGCCCCTGGGGGACGTGG + Exonic
1151657800 17:75503812-75503834 GAAGCAGCACCCAGCGGGCGGGG - Intronic
1151814463 17:76464614-76464636 GGAGCTGCTGCTGGAGGGAGAGG + Intronic
1152357967 17:79815698-79815720 TGAGAACCACCTGGAGGGCAGGG + Intergenic
1152560648 17:81077141-81077163 GGGGCAACTCCTGGTGGGCGTGG + Intronic
1152596807 17:81241815-81241837 TGAGCGCCACCTGCAGGGCGTGG + Intergenic
1152618449 17:81348664-81348686 GGAATAACACCTGGAGGGAGCGG + Intergenic
1152638380 17:81439452-81439474 GGAGCAGCAGTTGGACGGTGGGG + Intronic
1152823162 17:82447416-82447438 ACAGCAGCGCATGGAGGGCGCGG + Intronic
1153496514 18:5705020-5705042 AGGGCTGCTCCTGGAGGGCGTGG + Intergenic
1153517873 18:5921395-5921417 GGAGCAGGACCTGGAGTGAGTGG + Intergenic
1155168173 18:23247842-23247864 GTGGCAGCACCAGGAGGACGAGG - Intronic
1155618979 18:27754038-27754060 GGAGGAACACCTGGAGAGCAAGG + Intergenic
1156526896 18:37776268-37776290 GGAGCAGCATTTGGTGGGAGAGG + Intergenic
1160163338 18:76491587-76491609 GGAGAAGCACGGGGAGGGCCTGG - Intronic
1160189796 18:76706552-76706574 GGAGCCCCCACTGGAGGGCGGGG - Intergenic
1160432054 18:78819266-78819288 GGATGAGCCCCTGGAGGGTGGGG + Intergenic
1160505638 18:79425397-79425419 GGAGCAGCTTCAGGAGGGCGAGG - Intronic
1160779847 19:872844-872866 GGAGCAGGGCCTGGGAGGCGGGG + Intronic
1160996246 19:1883423-1883445 GGGGCAGCACCGGTAGGGCCTGG - Intronic
1161059863 19:2209533-2209555 GGTGCAGCGCGTGCAGGGCGCGG - Intronic
1161101774 19:2425059-2425081 GGAGGGGCAGCTGGAGCGCGTGG + Exonic
1161208397 19:3054031-3054053 GGAGCTGCTGCTGCAGGGCGGGG + Exonic
1161384317 19:3982902-3982924 GGAGCTGCAGCTGGAGCCCGAGG - Exonic
1161393052 19:4031335-4031357 AGAGCAGGACGTGGAGGGTGAGG + Intronic
1162017245 19:7852275-7852297 GAAGCACCAGCTGGAGGACGCGG - Intronic
1162925706 19:13929791-13929813 GGATGGGCACCTGGAGGGGGAGG + Intronic
1162925720 19:13929821-13929843 GGATGGGCACCTGGAGGGGGAGG + Intronic
1162925745 19:13929881-13929903 GGATGGGCACCTGGAGGGGGAGG + Intronic
1162925759 19:13929911-13929933 GGATGGGCACCTGGAGGGGGAGG + Intronic
1162925773 19:13929941-13929963 GGATGGGCACCTGGAGGGGGAGG + Intronic
1162962278 19:14135533-14135555 GCGGCAGCAACTGGTGGGCGTGG + Intronic
1163023512 19:14496139-14496161 GCAGCGGCGCCTGGGGGGCGGGG + Intronic
1163369968 19:16896460-16896482 GGCGCAGCAGCTGGGAGGCGCGG + Exonic
1163439742 19:17316090-17316112 GGAGCAGGGCCTTGAGGGCTGGG + Intronic
1163509409 19:17726218-17726240 GGTGCGGCACCTGGACCGCGTGG + Exonic
1163632684 19:18425294-18425316 TGAGCGGCCCCGGGAGGGCGGGG - Intronic
1164156948 19:22602829-22602851 GGAGCAGCACCGAGAGGAGGAGG + Intergenic
1164158000 19:22608095-22608117 GGAGCTGGACCTGGAGGGTGAGG + Intergenic
1164502438 19:28831294-28831316 GGAGCAGCAGGTGGAGGACCTGG + Intergenic
1165471364 19:36006626-36006648 GGACCAGGACTTGGAGGTCGAGG - Exonic
1165782824 19:38443796-38443818 GGTGCAGCAGCTGGAGGGGATGG + Exonic
1166190958 19:41176232-41176254 GGAGCGGAACCTGGAGGCCTGGG + Intergenic
1167015953 19:46841365-46841387 GGAGCAGTAGCTGGAGGCGGAGG - Intronic
1167098659 19:47390462-47390484 GGAGGAGCACAGGGAGGGAGGGG - Intergenic
1167145552 19:47679512-47679534 GGAGCAGACGCTGGAGGCCGAGG + Exonic
1167216537 19:48169645-48169667 GCAGCATCACCTGGAAGGAGTGG - Intronic
1167379104 19:49128405-49128427 GGAGCAGCTGCTGGAGAGGGAGG + Exonic
1167428854 19:49443040-49443062 GGAGCAGGACTGGGAGGGCAGGG - Intergenic
1167445281 19:49533866-49533888 GGTGCAGCACGTGCAGGCCGAGG + Intronic
1167594065 19:50418291-50418313 AGGTCAGCACCTGGAGGGCGGGG - Intronic
1168048386 19:53810395-53810417 CCAGCAGCAGCTGGAGGGTGGGG - Exonic
1168255453 19:55162123-55162145 GCGGCGGCACCTTGAGGGCGCGG + Exonic
1168354214 19:55691889-55691911 GGATCAGCAGCTGGAGGGACAGG - Exonic
925038972 2:715438-715460 GCAGCTGCATCTGGAAGGCGAGG - Intergenic
925194175 2:1910117-1910139 GGGGCAGGGACTGGAGGGCGGGG - Intronic
925859732 2:8162905-8162927 GGAGCAGAGCATGGAGGGTGGGG - Intergenic
926153293 2:10436239-10436261 GGAGCAGAAGCTGGCTGGCGAGG + Intergenic
926166484 2:10524438-10524460 GGAGCAGCAGCTGGAGGGTGTGG + Intergenic
926751103 2:16199144-16199166 GGAACAGCACCTGGAACACGAGG - Intergenic
926806510 2:16716634-16716656 GGAGCTGTACCTGGAAGGCAGGG - Intergenic
926982230 2:18584591-18584613 GCAGCAGCAGCGGGAGGACGAGG - Exonic
927093409 2:19729318-19729340 GCAGAAGCACCTGGAAAGCGGGG + Intergenic
927486484 2:23491747-23491769 TGAGCGGCATCTGGAGGGAGGGG - Intronic
927849436 2:26489647-26489669 GGAGCAGCCCCTGGCCGGCAGGG - Intronic
928024721 2:27730241-27730263 GGAGCAGCATCTGGGGAGCCAGG - Intergenic
929877337 2:45807803-45807825 GCAGGATCACCTGGAGGGCTTGG - Intronic
932615545 2:73228953-73228975 GGAGCAGCCCCTGGAAGAGGTGG + Exonic
932654817 2:73601343-73601365 GGGGCAGCACCTGGACGGTCGGG + Exonic
934518926 2:95007221-95007243 CGTGCAGCACCTGGAGTGGGGGG - Intergenic
934653102 2:96103545-96103567 GGAGCAGCAGCAGGAGGGAAGGG - Intergenic
934913661 2:98280629-98280651 GAAGCAGCGCCTGGAGAGGGAGG + Intronic
935237368 2:101150641-101150663 GGCGCAGCTCTTGGAGGCCGCGG - Intronic
936105098 2:109615962-109615984 AGAGCAGCCGCTGGAGGGCAGGG + Exonic
937278540 2:120702029-120702051 GGAGAAGCAGCTGGAAGGCAGGG - Intergenic
937854558 2:126663002-126663024 GGAGCAGCATCGGGAGCGAGAGG - Intronic
938492834 2:131774984-131775006 GGGGCAGCACCAGGAGGGGAGGG - Intergenic
938926741 2:136050153-136050175 TGAGCAGGGCCTGGAGGGAGGGG - Intergenic
939101329 2:137897833-137897855 GAAGCAGCAGCTGGAGGTTGGGG - Intergenic
942475191 2:176311886-176311908 GGTGCAGCCCATGGAGGGCTAGG - Intronic
942556575 2:177178120-177178142 CGAGGAGCACCTGCAGCGCGTGG + Intergenic
942944394 2:181657054-181657076 GGAGAAGGAGGTGGAGGGCGCGG + Intronic
943129703 2:183840147-183840169 GGAGCAACACGTGGTGGGTGGGG - Intergenic
946181775 2:217953287-217953309 TGAGGAGCACCCAGAGGGCGGGG - Intronic
946386219 2:219386056-219386078 GGAGCAGCAGCTGGTGCACGTGG - Exonic
946422900 2:219574995-219575017 GCAGCAGCACCAGGACGGGGTGG - Exonic
947874815 2:233461138-233461160 GAACCCGCACCTGGCGGGCGAGG - Intronic
948127056 2:235571883-235571905 GGAGCAGCAGCTGGATGTGGTGG - Intronic
948581000 2:238987039-238987061 GGAGAAGGATCTGGAGGACGAGG + Intergenic
948777953 2:240299545-240299567 GCAGCACCCCCTGGAGGGAGAGG - Intergenic
948823239 2:240560792-240560814 GGAGGAGCAGCTGGCGCGCGCGG + Exonic
948850076 2:240701531-240701553 GGAGCAGCGCGTGGAGCGCAGGG - Intergenic
1168998128 20:2147604-2147626 GGAGCTGCACTTGGTGGGCAGGG - Exonic
1169000403 20:2163996-2164018 GGGGCAGCAAGTGGAGGGTGAGG - Intronic
1169074356 20:2752085-2752107 GGAGCTGCTCCTGAAGCGCGCGG + Exonic
1169742715 20:8912786-8912808 GGCACAGCACTTGGAGGGAGAGG - Intronic
1170571738 20:17636576-17636598 GGTGCAGCAGCTGCAGGGCAAGG - Exonic
1170665311 20:18381371-18381393 GGAGCACCACCTGGTGGCTGAGG + Intergenic
1171037667 20:21729029-21729051 GGATCTGCACCTGGAGGGCAAGG + Intergenic
1171374390 20:24682345-24682367 GGAGCAGGAGGTTGAGGGCGTGG - Intergenic
1171724366 20:28602738-28602760 GGAGCAGCACCAGGGCGGGGAGG + Intergenic
1171788565 20:29497239-29497261 GGAGCAGCACCAGGGCGGGGAGG + Intergenic
1172061445 20:32189900-32189922 GGAGAAGCAGCAGGAGGGGGAGG - Intergenic
1172625296 20:36343196-36343218 GGAGCAGCATGTGGAAGGCAGGG + Intronic
1173631960 20:44523106-44523128 GGAACAGCACATGGAGAGAGGGG - Intergenic
1173743865 20:45421483-45421505 GCAGCAGCACCGGGAAGGCCCGG - Exonic
1173850485 20:46214752-46214774 GGAGCAGAGCCTGGAGGTCTGGG - Intronic
1173872440 20:46350462-46350484 GGAGCAGCAGCTCCAGGTCGGGG + Exonic
1174469310 20:50744433-50744455 GGAGAAGGACGTGGAGGGGGAGG - Intronic
1175699495 20:61126723-61126745 TGGGCAGGACCTGGAGGGTGGGG + Intergenic
1175803087 20:61812225-61812247 GGAGCAGCTAAGGGAGGGCGTGG + Intronic
1175824852 20:61931272-61931294 GGAGCTGCACCTGCAGTGCGTGG + Intronic
1176178326 20:63738809-63738831 GGAGCAGCACGTGCGGGGCTGGG + Exonic
1176201816 20:63864380-63864402 GCAGCGGCGCCTGCAGGGCGAGG + Intergenic
1176374319 21:6079663-6079685 GGACCGGCACCTGTGGGGCGGGG + Intergenic
1176385719 21:6137795-6137817 GGAGCAGTACCTGGCGTGCCAGG - Intergenic
1176428817 21:6564011-6564033 GGGGGAGCACCCTGAGGGCGGGG + Intergenic
1178976961 21:37228232-37228254 GGAGCTGCAGCTGGTGCGCGTGG - Exonic
1179494088 21:41760744-41760766 GGAGGAGCAGCTGGGGGGTGTGG + Intronic
1179704307 21:43172327-43172349 GGGGGAGCACCCTGAGGGCGGGG + Exonic
1179737754 21:43400457-43400479 GGAGCAGTACCTGGCGTGCCAGG + Intergenic
1179749157 21:43458582-43458604 GGACCGGCACCTGTGGGGCGGGG - Intergenic
1179881882 21:44296456-44296478 GGAGGAGCACCAGGAGGCCAGGG - Intronic
1180170410 21:46055372-46055394 GGAGGAGCACCTGGTGAGCTGGG + Intergenic
1180185307 21:46136431-46136453 GGAGCTGCACCTGGGAAGCGAGG + Exonic
1180297917 22:10961412-10961434 GGAGCAGCACCAGGGCGGGGAGG + Intergenic
1180926746 22:19560230-19560252 GGGGCAGCAACTGGAGGCAGGGG + Intergenic
1181235419 22:21445450-21445472 GGGGGAGCTCCTGGGGGGCGTGG - Exonic
1181507985 22:23374595-23374617 GGAGCAGCAGCATGGGGGCGTGG - Intergenic
1181602108 22:23958818-23958840 GGAGCTGGAGATGGAGGGCGAGG - Intronic
1181606402 22:23982489-23982511 GGAGCTGGAGATGGAGGGCGAGG + Intronic
1182149085 22:28016129-28016151 GCAGCAGGACTTGGAGGGCCAGG + Intronic
1182460750 22:30481887-30481909 GCAGCAGGAGCAGGAGGGCGGGG + Intergenic
1183149900 22:36028921-36028943 GTGGCAGCACCGGGAAGGCGGGG + Intergenic
1183180450 22:36256488-36256510 AGGGCAGCACCAGGAGGGCTTGG + Intronic
1183211871 22:36456034-36456056 GGAGCAGCAGGTGCAGGGCTGGG - Intergenic
1183386203 22:37516191-37516213 GGAGCAGCAACTGCAGGCCCGGG - Exonic
1183705297 22:39471960-39471982 GGAGGAGTCCCTAGAGGGCGAGG + Intronic
1183931480 22:41238279-41238301 GGAGCTGCTGCTGGACGGCGGGG - Exonic
1183956013 22:41381364-41381386 GGAACAGCCAATGGAGGGCGGGG - Intronic
1184642601 22:45880362-45880384 GGAGCAGCCCCTGGGTGGCCTGG - Intergenic
1184746426 22:46458728-46458750 GGTGCAGCACCAGGCGGGCGGGG - Intronic
1185278284 22:49959219-49959241 GAAGCAGCGGCTGGAGGGGGAGG + Intergenic
1185299601 22:50072502-50072524 GGGGCAGCACCTGATGGGCAGGG + Intronic
1185412814 22:50694929-50694951 GGAGCAGCAGCTGGTGGGGGAGG - Intergenic
949562284 3:5213917-5213939 GGGGCAGAAGCTGGAGGCCGAGG + Intronic
950425693 3:12923739-12923761 GCAGCAGCCCCTGGAGCACGAGG - Intronic
951709595 3:25574841-25574863 GGAGCAGAACCTGGAACTCGGGG + Intronic
953027801 3:39154645-39154667 GGAGCAGGACTGGGAGGGGGAGG - Intergenic
953207454 3:40844062-40844084 GGAGCAGCGCCCTGAGGGCATGG - Intergenic
954035685 3:47849796-47849818 GGAGGAGCAGCTGCAGAGCGGGG - Intronic
954378127 3:50205499-50205521 AGACCAGCGCCTGGAGCGCGCGG - Intronic
954417036 3:50398298-50398320 GGAGCAGCATGTGCAGGGCCTGG - Intronic
954581214 3:51703896-51703918 GGAGCTGGACTTGGAGGGCGAGG + Exonic
955098122 3:55820153-55820175 GGAGCCCCACATGGAGGGTGGGG + Intronic
955413117 3:58668584-58668606 GGAACAGCAACTGCAGGGAGGGG - Intergenic
961005670 3:123403749-123403771 GGAGCAGCTCCTGGTGGGCTGGG - Intronic
961056257 3:123791095-123791117 AGAACAGGACCTGGAGGGAGGGG + Intronic
961329739 3:126131497-126131519 GGAGCAGCACCAGGAGGAGCTGG - Exonic
961333039 3:126154189-126154211 GGAGCAGCACATTCAGGGCCAGG - Intronic
961423802 3:126829251-126829273 GGTGCAGCATCTGGAGAGTGAGG - Intronic
961935195 3:130575634-130575656 GGAGGAGCACCTGGAAGATGGGG - Intronic
962201540 3:133404377-133404399 GTGGCAGCAACTGGAGGGAGAGG + Intronic
962848179 3:139288884-139288906 GGAATAGCCCCTGGAGGGAGAGG + Intronic
963123347 3:141794309-141794331 GCACCAGCAGCTGGAGGGTGGGG + Intronic
967827986 3:193894216-193894238 GGGGCAGCATCTGGAGGGAGGGG - Intergenic
968083442 3:195863240-195863262 GTAGCACCACCTGGAGGCAGCGG - Intergenic
968332699 3:197885174-197885196 TGAGGAGCAGCAGGAGGGCGGGG - Intronic
968446257 4:653839-653861 ACAGCAGCACCTGGAGGGAGGGG - Exonic
968517196 4:1020397-1020419 GGAGCAGCACGTGGGGAGTGGGG + Intronic
968519790 4:1030153-1030175 GGAGCACCTCCTGGAGGCAGAGG + Intergenic
968736815 4:2301611-2301633 GGAGGAGCTTCTGGAGGGGGTGG + Intronic
968739486 4:2320070-2320092 GGAGGAGGACCTGGAGGCGGCGG + Intronic
968940611 4:3635584-3635606 GGACCAGCATCTGAAGGGGGCGG - Intergenic
968940627 4:3635658-3635680 GGACCAGCATCTGAAGGGCGGGG - Intergenic
968969855 4:3788155-3788177 GGGGCAGGAGCTGGAGGGCTGGG - Intergenic
969146103 4:5125493-5125515 GCAGCAGCACCTGGTGTGGGTGG + Intronic
969214069 4:5708927-5708949 GGAGAAGCATTTGGAGCGCGGGG + Intronic
969612759 4:8236367-8236389 GGAGGAGCCCCAGGAGGGCTTGG + Exonic
969979191 4:11136927-11136949 GGAATAGCACCTGGAGGCCTTGG + Intergenic
970548420 4:17153805-17153827 GGAGCATCCCGGGGAGGGCGTGG + Intergenic
970604400 4:17665894-17665916 GAAGCAGCAACTGGGGGGCGGGG - Intronic
971640118 4:29120275-29120297 GGAGCAGCACCGAGAGAGTGAGG - Intergenic
975689213 4:76948830-76948852 GGGGCTGCGGCTGGAGGGCGTGG - Intergenic
976390056 4:84497854-84497876 GGAGGAGGAACCGGAGGGCGAGG + Exonic
983077488 4:163343887-163343909 GGAGCAGGACCTGGAGGCGGCGG - Intronic
985033276 4:185813630-185813652 GTAGCAGCATCTGCAGGGCAAGG - Intronic
985532737 5:443401-443423 GGACCGGGACCTGGAGGGCGGGG + Intronic
985635325 5:1033061-1033083 GGAGCATCTCCTGGAGGCCCAGG + Intronic
985656429 5:1133883-1133905 GGAGCTGCAGCTGGAGGTGGGGG + Intergenic
985722661 5:1497875-1497897 GGGGCAGCCCCTGGAGGACCTGG + Intronic
985781215 5:1872767-1872789 GGACCAGCACCTGCAGGCCCTGG + Intergenic
986195531 5:5533957-5533979 GGAGCAGCACCCGAAGGACATGG - Intergenic
986297052 5:6448629-6448651 GCAGCAGCACCCCGGGGGCGCGG + Exonic
986344610 5:6823023-6823045 GGAGCAGCGCGTAGAGGGTGAGG - Intergenic
987234380 5:15928263-15928285 GGGTCAGCACCTTGAGGGCGCGG - Exonic
988309780 5:29542150-29542172 GGTGCAGCCCATGGAGGGCGAGG - Intergenic
989159844 5:38379599-38379621 GGAGCAGCACATTCAGGGAGGGG - Intronic
989170508 5:38467499-38467521 GTAGCAGCTCCTGCAGGGCCAGG - Intergenic
989318018 5:40104531-40104553 GGAGGAGTAGCTGGAGGGAGAGG - Intergenic
991371786 5:65926344-65926366 GCAGCAGCACCCGGCCGGCGGGG - Intergenic
991432330 5:66561473-66561495 GGGGCAACAACTGGAGGGTGGGG - Intergenic
992398133 5:76386517-76386539 GGAGCTGTACCTGCAAGGCGAGG + Intergenic
992435931 5:76756178-76756200 GGAGCAGCAGCTCAAGGGCCCGG + Intergenic
996337605 5:122401778-122401800 TGAGCAGCACCTGGCTGGTGTGG - Intronic
997360194 5:133290112-133290134 GGTGCAGCACCAGCAGGGTGTGG + Intronic
998098659 5:139413475-139413497 TGAGCAGCATCTGGAGGCGGGGG - Exonic
998184260 5:139966734-139966756 GCAGGAGGACCTGGAGGGCCTGG + Intronic
999373101 5:151068176-151068198 GGAGCCACCCCTGGAGGGCCTGG + Intronic
999386499 5:151157547-151157569 GGAGCAGGGACGGGAGGGCGCGG - Intronic
1000038465 5:157466947-157466969 GGAGCAGCCCTTAGAGGCCGGGG + Intronic
1001932520 5:175683431-175683453 AGGGCAGCACCAGGAGGCCGAGG - Exonic
1002453226 5:179331385-179331407 GGAGGAGAAGCTGGAGGGAGAGG + Intronic
1002633401 5:180595524-180595546 AGGGCAGCACTTGGAGGGCATGG - Intergenic
1002649490 5:180681153-180681175 GGACCAGCAGCTGGGGGGCAGGG + Intergenic
1003405585 6:5824597-5824619 GGAGCAGCATCTGGAGAGGATGG - Intergenic
1005685698 6:28251617-28251639 GGAGCAGCATCCAGAGAGCGGGG - Exonic
1005696911 6:28359907-28359929 GGAGCAGCATCCAGAGAGCGGGG + Exonic
1006158543 6:32028520-32028542 GCAGCAGCACCTGGTGAGCTTGG + Exonic
1006924878 6:37648747-37648769 TGGCCCGCACCTGGAGGGCGGGG + Intronic
1006940935 6:37751896-37751918 AGAGCAGGACCTGAAGGGGGTGG - Intergenic
1007987377 6:46220519-46220541 TGAGCAGGGCCTGGAGGGCAGGG - Intergenic
1008420935 6:51298382-51298404 GGAGCAGCAGCTGGAGAACTTGG - Intergenic
1009627020 6:66147003-66147025 GCAGCAGCATCTGGGGGGCGAGG + Intergenic
1013373466 6:109490906-109490928 GGGGCAGCAGCTGGAGGATGGGG + Intergenic
1015075389 6:129150417-129150439 GGAGCAGCACTTGAAGGTAGGGG + Intronic
1016190611 6:141260812-141260834 GCAGCTGCACCTGGATGGCAGGG - Intergenic
1017048568 6:150369870-150369892 GCAGAAGCACCTGGAGGCCTGGG + Intronic
1017777230 6:157689696-157689718 TGAGCAGCACCTGGGGGCCGTGG + Intergenic
1017812881 6:157996767-157996789 GGAGCAGGACCAAGAGGGTGGGG - Intronic
1017871961 6:158494016-158494038 GCTGCAGCACCCGGAGGGTGAGG - Intronic
1018222210 6:161592745-161592767 GGACCAGCACTAGGAGGACGAGG + Intronic
1018818734 6:167356259-167356281 GGAGCAGCACCTGGGTGGAATGG + Intronic
1019389790 7:779605-779627 GGAGCAGGAGGTGGAGGGCCAGG + Intronic
1019395589 7:816358-816380 GGGGCTGCACCTGGAGGAGGGGG - Intergenic
1019515348 7:1437565-1437587 GGAGCAGCAGCTGGACATCGAGG - Exonic
1019716611 7:2542171-2542193 GGAGAAGGACCTGGAAGGCCTGG + Exonic
1020275896 7:6624183-6624205 GGAGAAGCAGCTGGGGGGAGAGG - Exonic
1022698130 7:32729134-32729156 GAAGCAGCCCCTGGCGGGCTGGG - Intergenic
1023570390 7:41565640-41565662 GGGGCTGCCCCTGGAGGGAGTGG + Intergenic
1023616901 7:42029192-42029214 GGAGCAGCAGCAGAAGGTCGAGG - Intronic
1023881955 7:44325714-44325736 GGAGCAGCGTGTGCAGGGCGCGG - Intronic
1025614631 7:63107041-63107063 GCAGCAGCTCCTGGAGAGAGTGG - Intergenic
1026381054 7:69799785-69799807 GGAACAGCACCAGGAGGGGGCGG - Intronic
1026760540 7:73122770-73122792 GGAGCAGCAGGTGGAGGCCAAGG + Intergenic
1026923744 7:74174564-74174586 GGAGCGGCGCCTGGAGGGCCGGG + Intronic
1026929171 7:74213711-74213733 GGAGGAGCTCCAGCAGGGCGTGG - Intronic
1026941518 7:74290150-74290172 GGAGCACAGCCTGGTGGGCGCGG + Intronic
1027036882 7:74931591-74931613 GGAGCAGCAGGTGGAGGCCAAGG + Intergenic
1027086681 7:75269868-75269890 GGAGCAGCAGGTGGAGGCCAAGG - Intergenic
1027916807 7:84334817-84334839 GGAGCAGGACCAGGAGGGGAGGG - Intronic
1028601684 7:92607730-92607752 GGAACAGCACCTGACAGGCGGGG - Exonic
1028682418 7:93551677-93551699 GGAGCATCTCCTGGATGGAGAGG + Intronic
1029846278 7:103415313-103415335 GGAGCAAAACCTGGAGGAAGAGG - Intronic
1030005335 7:105112797-105112819 GGGGCAGGACCAGGAGGGGGTGG - Exonic
1031555967 7:123176773-123176795 GGAGGAGAACCAGGAGGGTGTGG - Intronic
1032122826 7:129169202-129169224 GGAGAAGGTCCTGGAGGGCCCGG - Intronic
1033586680 7:142779565-142779587 TGGGCAGCACCTGGAGGACCAGG + Intergenic
1034306576 7:150048757-150048779 GGAGAGCCACCAGGAGGGCGCGG + Intergenic
1034438494 7:151075019-151075041 GGAACAGCACGTGGAGGGGCAGG + Intronic
1034446718 7:151117444-151117466 GGAGCATCACCTGGAGCTCAGGG - Exonic
1034546921 7:151795180-151795202 GGGGCAGCACCTAGAGGGACAGG + Intronic
1034800270 7:154051886-154051908 GGAGAGCCACCAGGAGGGCGCGG - Intronic
1035109704 7:156470925-156470947 GGAGCAGGAGCAGGAGAGCGGGG - Intergenic
1035433219 7:158838058-158838080 GGAGCAGGACCTAGAGAGAGGGG + Intergenic
1037828912 8:22176948-22176970 GGAGCAGCACCTGGAGGGCGGGG - Exonic
1038254844 8:25941754-25941776 GGAGCAGCACCTGTAGGGGCAGG - Intronic
1039133770 8:34297404-34297426 GGTGCAGCCCATGGAGGGCGAGG + Intergenic
1039238168 8:35525679-35525701 GGAGCAGCGGCTGCAGGGCGAGG - Intronic
1040951352 8:52941069-52941091 CGCGCATCACCTGGAGGGCTTGG - Exonic
1041930674 8:63283151-63283173 GGGGCAGAACCTGGAAGGCCAGG + Intergenic
1043499500 8:80838660-80838682 GAAGCAGAACCTGGAGGAGGAGG + Intronic
1047473484 8:125202200-125202222 GGTGCAGCCCATGGAGGGCAAGG - Intronic
1048008492 8:130438309-130438331 GAAGAAGCAACTGGAGGGCCTGG - Intronic
1048365320 8:133733269-133733291 GGAGTCGCACCTGGGGAGCGGGG - Intergenic
1049324276 8:142013973-142013995 GGACCAGCACCTGGAGGGTGGGG - Intergenic
1049431446 8:142567138-142567160 GGAGCAGCTGCTGGAGGGTCCGG - Intergenic
1049708206 8:144052376-144052398 GGAGTAGGAGCGGGAGGGCGAGG - Intronic
1049796356 8:144498945-144498967 GCAGCAGCTCCTGGAGGCTGGGG + Exonic
1049814464 8:144591674-144591696 GCCTGAGCACCTGGAGGGCGGGG + Intronic
1049871723 8:144984327-144984349 GCAGCAGCATTTGGAGGGGGAGG - Intergenic
1052709964 9:32042152-32042174 GGAGCAGCAGCTGGAGGATGGGG - Intergenic
1053425606 9:38008092-38008114 ACAGGAGCACCTGGAGGGCAAGG + Intronic
1053459511 9:38257719-38257741 TCAGCATCACCTGGAGGGCTTGG - Intergenic
1053527652 9:38846143-38846165 GGAGCAGCACCTGGAGACCAGGG + Intergenic
1053725231 9:40992344-40992366 GGAGCAGCACCAGGGCGGGGAGG - Intergenic
1054199878 9:62070572-62070594 GGAGCAGCACCTGGAGACCAGGG + Intergenic
1054340710 9:63859536-63859558 GGAGCAGCACCAGGGCGGGGAGG + Intergenic
1054638478 9:67517785-67517807 GGAGCAGCACCTGGAGACCAGGG - Intergenic
1056928422 9:90854292-90854314 GGAGAGGCACCTGGAGAGCTGGG + Intronic
1057147509 9:92768210-92768232 GGAGAAGCAGCTGGATGTCGGGG - Intergenic
1057151928 9:92803754-92803776 AGAGAAGCCCCTGGAGGGAGGGG + Intergenic
1057263701 9:93600332-93600354 GAGGCAGCTCCTGGAGGGCAGGG + Intronic
1057881576 9:98796449-98796471 GCAGCAGCAGCTGGAAGGCCGGG + Exonic
1057995958 9:99821922-99821944 GGAGCAGGAGCTGGAGGGGTGGG - Exonic
1059326532 9:113507274-113507296 GGGGCAGCTCCTGGAAGGTGGGG - Exonic
1059426413 9:114223462-114223484 GGAGCAGAACCTGGGTGGGGTGG + Intronic
1059433656 9:114264282-114264304 GGCGGAGAACCAGGAGGGCGGGG - Intronic
1059522990 9:114961493-114961515 GCAGCAGAAGCTGGAGAGCGAGG + Intergenic
1059759835 9:117327348-117327370 ACAGCAGCACCTGGAGGGGATGG + Intronic
1060658571 9:125389250-125389272 GGGGCAGCACGTGGAAGGCTAGG - Intergenic
1061062463 9:128257516-128257538 GCAGCTTCACCTGGAGGGAGGGG + Exonic
1061425627 9:130496676-130496698 GGAGGAGCCCCTGGAGGGGCAGG + Intronic
1061965009 9:134008459-134008481 GGAGGACCACCTGGAGGGCAAGG - Intergenic
1062064407 9:134518389-134518411 GGAACTGCACCTGGTGGGGGCGG + Intergenic
1062109253 9:134773053-134773075 TGGGCAGCAACTGGAGGGTGGGG - Intronic
1062357446 9:136171519-136171541 GGAACAGCATCTGCAGGGCTTGG - Intergenic
1062372473 9:136247205-136247227 GGAGCCGGACCTGGTGGGAGCGG + Intergenic
1062589302 9:137266336-137266358 GGAGCAGCAGCAGGAGGTCGGGG - Exonic
1062652827 9:137587085-137587107 GGAGCGGCACCGGGGGGGCGTGG - Exonic
1203780237 EBV:96628-96650 GGAGCAGGAGGTGGAGGCCGGGG + Intergenic
1203449569 Un_GL000219v1:99537-99559 GGAGCAGCACCAGGGCGGGGAGG + Intergenic
1186585595 X:10869964-10869986 GGTGCAGCCCATGGAGGGCGAGG + Intergenic
1186739742 X:12505126-12505148 GGAGAAGCACCTGGAGGACCAGG + Intronic
1190499576 X:51061418-51061440 GGAGCAGGACCAGGAGAGAGAGG - Intergenic
1192034206 X:67545760-67545782 GCAGCAGCAGCGGGAGAGCGAGG + Exonic
1192343268 X:70281295-70281317 AGAGCAGAAGGTGGAGGGCGGGG - Intronic
1192358940 X:70426358-70426380 GCAGCAGCACCTGGGGGGCCAGG - Exonic
1195321725 X:103726629-103726651 GCAGCAGCACCTGGCTAGCGTGG - Intronic
1195722411 X:107879092-107879114 GCAGCAGCATCTGGCGGGGGTGG + Intronic
1196707541 X:118728539-118728561 GGAGCAGCTCCTGGAAGGAATGG + Intronic
1198767211 X:140091748-140091770 GGAGCAGCAGAAGGAGGGCGAGG + Intergenic
1200062563 X:153490081-153490103 GGAGCAGCACCAGGAGGCTCTGG - Intronic
1200068640 X:153517317-153517339 GGAGACGCACCTAGAGGGCAGGG + Intergenic
1200151265 X:153952538-153952560 GGAGCACCGCCTGGATGGCCAGG + Exonic
1200203052 X:154295711-154295733 GGAGCGGCAGGTGGAGGGAGTGG + Exonic
1200216175 X:154369157-154369179 CAGGCAGCACCTGGAGGGCCAGG + Intronic