ID: 1037828914

View in Genome Browser
Species Human (GRCh38)
Location 8:22176950-22176972
Sequence TAGGAGCAGCACCTGGAGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 374}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828914_1037828921 -5 Left 1037828914 8:22176950-22176972 CCGCCCTCCAGGTGCTGCTCCTA 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828914_1037828926 6 Left 1037828914 8:22176950-22176972 CCGCCCTCCAGGTGCTGCTCCTA 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1037828926 8:22176979-22177001 TCGCCGCGGCGGGGGCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218
1037828914_1037828923 -4 Left 1037828914 8:22176950-22176972 CCGCCCTCCAGGTGCTGCTCCTA 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828914_1037828924 -3 Left 1037828914 8:22176950-22176972 CCGCCCTCCAGGTGCTGCTCCTA 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1037828914_1037828928 19 Left 1037828914 8:22176950-22176972 CCGCCCTCCAGGTGCTGCTCCTA 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1037828928 8:22176992-22177014 GGCCCCCAGGCCATCTCCATCGG 0: 1
1: 0
2: 2
3: 13
4: 184
1037828914_1037828920 -8 Left 1037828914 8:22176950-22176972 CCGCCCTCCAGGTGCTGCTCCTA 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1037828920 8:22176965-22176987 TGCTCCTACGTGGGTCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 33
1037828914_1037828925 -2 Left 1037828914 8:22176950-22176972 CCGCCCTCCAGGTGCTGCTCCTA 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828914 Original CRISPR TAGGAGCAGCACCTGGAGGG CGG (reversed) Exonic
900176857 1:1294899-1294921 TAGGGGTGGCCCCTGGAGGGTGG - Intronic
900189545 1:1347506-1347528 CAGGAGCAGAACCTGGGGGCTGG + Intronic
900880335 1:5376996-5377018 TGGGAGCCTCACCTGCAGGGAGG + Intergenic
901201448 1:7469605-7469627 TCGGGGCAGCACCTGGAAGCTGG + Intronic
902442544 1:16440547-16440569 AAGGAGAAGCCTCTGGAGGGAGG + Intergenic
903790035 1:25886535-25886557 AGGGAGCAGCACATGGAGGGTGG - Intronic
904042440 1:27592575-27592597 TAAGAGCAGGGCCTGGGGGGGGG - Intronic
904360122 1:29965733-29965755 CAGGAGCAGCCCCAGCAGGGTGG + Intergenic
906652070 1:47519965-47519987 CAGGATAAGCACCTGGAGTGGGG + Intergenic
906794721 1:48687802-48687824 CAGGAGCAGGACCTGAAGGCAGG - Intronic
906952804 1:50348502-50348524 TCCAAGCAGCACTTGGAGGGTGG - Intergenic
907110957 1:51925951-51925973 GAGGAGCAGCCCCTGCTGGGGGG + Intronic
908102699 1:60807863-60807885 TAGCAGCAGCAGCTGCAGGCAGG + Intergenic
909074113 1:71032579-71032601 TAGGAGCAGAGCCTGAAGTGGGG + Intronic
909764206 1:79334371-79334393 GAGGAGCAGCAACTTTAGGGCGG + Intergenic
910209222 1:84776444-84776466 TTGGACCAGCATCTGGGGGGTGG + Intergenic
910847520 1:91617663-91617685 AAGCAGCAGCACCTGCAGGTCGG + Intergenic
911649042 1:100366584-100366606 TAGGACCTGCACCTGTGGGGTGG + Intronic
911687851 1:100797610-100797632 TAGGAGAATCACCTGGACTGGGG + Intergenic
912167472 1:107057502-107057524 TTGGAGCAGGAGCTGGAGGCCGG + Exonic
913101140 1:115567831-115567853 TAGGAGAAGTACTTGGTGGGAGG + Intergenic
914452489 1:147805087-147805109 TTGGAGCAAAAACTGGAGGGAGG + Intergenic
914663209 1:149810896-149810918 CAGGAGAAGCACCTGGAAGCAGG + Intronic
915367863 1:155325447-155325469 CAGGAGCAGCCCCTGGAGCGTGG + Exonic
915473737 1:156140389-156140411 GAGAAGCAGCACCTGAAGGAGGG + Intergenic
915475519 1:156150601-156150623 AAGGAGCAGCTCCTGGAGCCAGG - Intronic
915711321 1:157902010-157902032 TGGGTGCAGCCCATGGAGGGTGG + Intergenic
917519426 1:175735749-175735771 TGGTAGAAGAACCTGGAGGGAGG + Intronic
918605443 1:186419478-186419500 TAGGAGCATCACCTGGGGCTGGG + Exonic
920031605 1:203040738-203040760 TCATACCAGCACCTGGAGGGAGG + Intronic
920265314 1:204717138-204717160 TGGGAGCAGCAGGTTGAGGGAGG + Intergenic
920843836 1:209577003-209577025 GAGGAGCAGCACCTGGAGGTAGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921929680 1:220745073-220745095 TAGGAGCAGGACCCAGAGAGAGG - Intergenic
922745013 1:228038613-228038635 TGGGGGCAGCACCAGGAGGGAGG + Intronic
1062977194 10:1692986-1693008 CAGGACTAGCACCTGGAGGGTGG - Intronic
1063563048 10:7147713-7147735 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563059 10:7147754-7147776 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563070 10:7147795-7147817 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563081 10:7147836-7147858 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563112 10:7147959-7147981 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563123 10:7148000-7148022 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563134 10:7148041-7148063 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563144 10:7148082-7148104 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563155 10:7148123-7148145 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563165 10:7148164-7148186 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563176 10:7148205-7148227 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563186 10:7148246-7148268 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1065235623 10:23648668-23648690 TAGCAGAAGCACTTGGAGAGGGG + Intergenic
1067180240 10:43979823-43979845 GAGGAGCAGCCCCTGGAAGCTGG + Intergenic
1068044743 10:51871758-51871780 TAGGTCCAACACCTGGAGGGAGG + Intronic
1069208451 10:65723858-65723880 TAGGGGCAGGACCAGGTGGGAGG - Intergenic
1069734601 10:70645471-70645493 TGGGTGCAGCTCATGGAGGGTGG - Intergenic
1070141926 10:73744578-73744600 TAGGACCTGCTCCTGGATGGTGG - Intronic
1071276108 10:84056711-84056733 TAAGGGCAGCATCTGCAGGGTGG + Intergenic
1071603987 10:86972132-86972154 TAGGACCTGCTCCTGGAGGCAGG - Intronic
1073283857 10:102375348-102375370 GGAGAGCAGCACCTGGAGTGGGG - Exonic
1073404514 10:103285521-103285543 TAGGAGGATCACCTGGAGTCGGG - Intronic
1073528736 10:104211493-104211515 TAGGAGCAAACCCGGGAGGGAGG - Intronic
1075224344 10:120612888-120612910 TAGAAACAGGACCTGGAGGTTGG + Intergenic
1075625628 10:123962744-123962766 CAGAGGCAGCACCTGGAGAGAGG - Intergenic
1075643130 10:124079695-124079717 TGGAGGCAGCACCAGGAGGGAGG + Intronic
1076543872 10:131231058-131231080 TAGTATGAGGACCTGGAGGGGGG + Intronic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077036961 11:499912-499934 GAGGTGCAGCTCCTGCAGGGTGG + Exonic
1077342864 11:2033713-2033735 TGGGGGCAGCACCAGCAGGGTGG + Intergenic
1077363871 11:2153663-2153685 GAGGAGCAGCTCCTCGAGGGAGG - Intronic
1077368562 11:2171199-2171221 TAGCAGCAGCTCATGGTGGGGGG - Intronic
1077713701 11:4559926-4559948 CTGGGACAGCACCTGGAGGGAGG + Intergenic
1077845054 11:6014362-6014384 TGAGAGCAGCACCCGGAGGATGG - Intergenic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079452353 11:20608005-20608027 TAGCAGCATTACCTGGATGGTGG + Intronic
1079504101 11:21133853-21133875 CTGCAGCTGCACCTGGAGGGTGG + Intronic
1079693907 11:23454823-23454845 TTGGAGAAACACCTGGAGGTGGG + Intergenic
1080429316 11:32184143-32184165 AAGGAACAGCAACTGGAGGCTGG + Intergenic
1080497407 11:32833225-32833247 AAGCAGCAGCCCCTGGAAGGCGG + Intronic
1081263253 11:40987135-40987157 TAGAAGGATGACCTGGAGGGAGG - Intronic
1081590208 11:44417490-44417512 TAGGAGCAGTACCGAGAGAGTGG + Intergenic
1082080828 11:48011323-48011345 TAGGAGCTGGACTTGGAGGCAGG + Intronic
1083077506 11:60056294-60056316 TAAGAGAAGCATCTGGAGGAGGG - Intergenic
1083174624 11:60941891-60941913 CAGGAAAAGCACCTGGAGGGTGG - Intronic
1083273177 11:61582182-61582204 TAGGGGCAGCACCTGTATTGTGG - Intergenic
1084209045 11:67612526-67612548 CAGCAGCGGCAGCTGGAGGGTGG - Intronic
1084801603 11:71547780-71547802 TTGGAGCAGAACTTGGAGGGTGG - Intronic
1084944680 11:72632250-72632272 CAGGAGCTGCACCTGGTGTGTGG + Intronic
1085865181 11:80282405-80282427 TGGGACTAGAACCTGGAGGGGGG - Intergenic
1086297000 11:85380429-85380451 CAGGAGGATCACCTGGAGGTTGG + Intronic
1089589234 11:119529936-119529958 TAGAAACAGCAGCTGGAGGAAGG - Intergenic
1090056825 11:123430946-123430968 CAGGAGCAGAGCCTGGAGGCCGG + Exonic
1090058198 11:123441307-123441329 TAGGAGGAGAACCTGGTGGGAGG - Intergenic
1090832056 11:130427023-130427045 AAGGAGCTGAACCTGGAGAGGGG - Intronic
1090927036 11:131258544-131258566 TAGGAGCAGCCCAGGGAGGAGGG + Intergenic
1090977243 11:131688518-131688540 TGGGAGCAGCAGGCGGAGGGAGG - Intronic
1202825850 11_KI270721v1_random:88902-88924 TGGGGGCAGCACCAGCAGGGTGG + Intergenic
1091763547 12:3103695-3103717 AAGGACTAGCACCTGGAGAGTGG + Intronic
1092522886 12:9291837-9291859 TCCCAGCAGCACCTGGAGGGCGG - Intergenic
1092544402 12:9440060-9440082 TCCCAGCAGCACCTGGAGGGCGG + Intergenic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1094508547 12:31082007-31082029 TCCCAGCAGCACCTGGAGGGCGG - Intronic
1096155914 12:49341593-49341615 TAGGAGCAGCACCTGGCCAGGGG - Intergenic
1096574522 12:52544422-52544444 TGGGAGCAGGACCAGCAGGGTGG + Exonic
1096717577 12:53500519-53500541 AAGAAGCAACACCTGAAGGGAGG + Intergenic
1096777401 12:53972750-53972772 TGTGAGCAGCACCAGGAGGGTGG - Intergenic
1096887025 12:54728283-54728305 TAGGGCCAGGACCTGGTGGGAGG - Intergenic
1098350024 12:69548917-69548939 TAGGAGCCTCACCTGCATGGAGG - Intronic
1098610998 12:72458105-72458127 TAGCACCATCACCTGAAGGGAGG - Intronic
1100112087 12:91257907-91257929 TTGGAGCAATACCTGGAAGGAGG + Intergenic
1100980130 12:100157047-100157069 CAGCAGCTTCACCTGGAGGGAGG + Intergenic
1102912334 12:116726494-116726516 TACTAGCAGGACCGGGAGGGGGG + Intronic
1103590365 12:121987857-121987879 TAGGAACAGAACCTGGAGTTGGG - Intronic
1103938683 12:124490177-124490199 TTGGAGCTGAACCTGGAGGAAGG - Intronic
1104425764 12:128676984-128677006 AAGGAGCAGCACCTAGAGAAGGG + Intronic
1104835461 12:131787120-131787142 TTGGAGCAGGAGATGGAGGGAGG + Intronic
1104861812 12:131927972-131927994 AAGGCACAGCCCCTGGAGGGCGG + Intergenic
1104900843 12:132188857-132188879 GAGGAGCAGGAGCAGGAGGGAGG + Intergenic
1105074085 12:133260114-133260136 TAGGGGAAGGACCTGGTGGGAGG - Intergenic
1106621406 13:31374330-31374352 TCCCAGAAGCACCTGGAGGGAGG + Intergenic
1111309200 13:86459214-86459236 TAGGTGCAGCTCCTGCTGGGAGG - Intergenic
1112607082 13:100917077-100917099 TAGGAGCAGCACGAAGAGGGTGG + Intergenic
1113587763 13:111476899-111476921 TGGGGGCAGGACCTGGTGGGAGG + Intergenic
1113751429 13:112779068-112779090 GAGGAGTAGCCCCTGGAGTGAGG + Intronic
1113767743 13:112891551-112891573 TGGGCGCTGCACATGGAGGGGGG - Intergenic
1115951197 14:38724058-38724080 TAAGAGTAGAACCGGGAGGGTGG + Intergenic
1116041098 14:39687131-39687153 AAGGAGCAGCACCTGGGGAATGG - Intergenic
1117258080 14:54000683-54000705 CTGCAGCAGCTCCTGGAGGGAGG - Intergenic
1117790100 14:59331352-59331374 GAGGAGGGCCACCTGGAGGGAGG - Exonic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118804523 14:69224003-69224025 CAGGAGCAGCACCAAGACGGCGG + Intronic
1119260545 14:73235822-73235844 GAGGAGCAGCAGCTGTAGCGGGG - Intergenic
1121396301 14:93626279-93626301 TAGGTGCAGAAGCTGGAAGGTGG - Intronic
1121568215 14:94926356-94926378 CAGGAGCAGCACCTGGGCTGTGG - Intergenic
1121767156 14:96497800-96497822 GACCAGCAGCAGCTGGAGGGAGG + Intergenic
1121950944 14:98170796-98170818 TCGCATGAGCACCTGGAGGGAGG + Intergenic
1122258390 14:100497825-100497847 AAGCAGCATCACCTGGCGGGGGG - Intronic
1122419053 14:101564024-101564046 TAGGAGCCGCAGCTGGAGTGAGG - Intergenic
1122486871 14:102087479-102087501 TGGGAGGCGCGCCTGGAGGGAGG + Intronic
1123473707 15:20572308-20572330 CAGCAGCTTCACCTGGAGGGAGG - Intergenic
1123644302 15:22428045-22428067 CAGCAGCTTCACCTGGAGGGAGG + Intergenic
1123665610 15:22607944-22607966 CAGCAGCTTCACCTGGAGGGAGG + Intergenic
1123734007 15:23167319-23167341 CAGCAGCTTCACCTGGAGGGAGG - Intergenic
1124284510 15:28388630-28388652 CAGCAGCTTCACCTGGAGGGAGG - Exonic
1124298187 15:28522984-28523006 CAGCAGCTTCACCTGGAGGGAGG + Exonic
1124319435 15:28702358-28702380 CAGCAGCTTCACCTGGAGGGAGG + Exonic
1124483081 15:30093073-30093095 CAGCAGCTTCACCTGGAGGGAGG - Exonic
1124489529 15:30145141-30145163 CAGCAGCTTCACCTGGAGGGAGG - Exonic
1124520502 15:30404145-30404167 CAGCAGCTTCACCTGGAGGGAGG + Exonic
1124538155 15:30562074-30562096 CAGCAGCTTCACCTGGAGGGAGG - Exonic
1124544621 15:30614135-30614157 CAGCAGCTTCACCTGGAGGGAGG - Exonic
1124564576 15:30801564-30801586 CAGCAGCTTCACCTGGAGGGAGG - Intergenic
1124753998 15:32393186-32393208 CAGCAGCTTCACCTGGAGGGAGG + Exonic
1124760498 15:32445511-32445533 CAGCAGCTTCACCTGGAGGGAGG + Exonic
1124778138 15:32603551-32603573 CAGCAGCTTCACCTGGAGGGAGG - Exonic
1125613837 15:40992113-40992135 TTGGACCAACACTTGGAGGGTGG + Intronic
1125797184 15:42411464-42411486 TAGGAACAGAACATGGAGGGAGG + Intronic
1126953741 15:53911204-53911226 TTGGAGCAGGACCTGGGGGTGGG + Intergenic
1127354210 15:58182625-58182647 TAGGGGAGGCACATGGAGGGTGG - Intronic
1127772529 15:62243169-62243191 CAGCAGCTTCACCTGGAGGGAGG + Intergenic
1128321304 15:66696614-66696636 TGGGAGCAGGACCTGGTAGGAGG - Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1129456725 15:75680093-75680115 TAGGAGCAGAACCCGGAGTAAGG + Intronic
1129903997 15:79173153-79173175 CCGGAGCTGGACCTGGAGGGTGG - Intergenic
1130104481 15:80919265-80919287 TAGGAGCAGCACCTGAGCTGGGG - Intronic
1130394238 15:83488273-83488295 TGGGAGCAGCGCCTGCAGGCAGG - Intronic
1130725282 15:86432837-86432859 GAGGAGCAGCCCCTGGCAGGTGG + Intronic
1131441323 15:92461677-92461699 TGGGAGCTGAAGCTGGAGGGTGG + Intronic
1131790417 15:95958441-95958463 AAGGAGAAGCATCTGGAGGCTGG - Intergenic
1132184652 15:99792558-99792580 CAGCAGCTTCACCTGGAGGGAGG - Intergenic
1132590871 16:725961-725983 AAGGAGCAGCAGCTGCAGGTGGG - Exonic
1132599703 16:768054-768076 GAGGAGGGGCACATGGAGGGGGG + Intronic
1132701699 16:1224872-1224894 CCTGAGCAGGACCTGGAGGGCGG - Intronic
1132758204 16:1496200-1496222 TCGGGGCAGCATGTGGAGGGTGG - Intronic
1132989714 16:2786512-2786534 AAGGAGCAGGACCTGGAGACAGG + Exonic
1133040637 16:3058432-3058454 CAGGACCGGCAGCTGGAGGGCGG + Exonic
1133341883 16:5041909-5041931 TAGGAACAGCTCCTTGAGGCAGG + Intronic
1136293633 16:29290073-29290095 CAGGAGCAGGTCCTGGGGGGTGG - Intergenic
1136374762 16:29858954-29858976 CAGGAGCACCGCCTGGATGGAGG + Exonic
1137615462 16:49843803-49843825 TAGGAACAGCACTAGGAGTGAGG - Intronic
1138438978 16:57023098-57023120 TAGGAACAGCCCCTGGAGCAGGG - Intronic
1139405958 16:66717892-66717914 TGGGAGCAACCCGTGGAGGGAGG - Intergenic
1139675304 16:68519434-68519456 TGGGAGCACCACATGGAAGGGGG - Intergenic
1140765058 16:78149821-78149843 TAGAAGCAGCTCCTGGAGGCAGG - Intronic
1141740283 16:85887122-85887144 TATGAGCTGCACCTGAACGGGGG - Intergenic
1142099515 16:88264079-88264101 CAGGAGCAGGTCCTGGGGGGTGG - Intergenic
1142283737 16:89162517-89162539 GGGCAGCCGCACCTGGAGGGTGG - Intergenic
1143095815 17:4477767-4477789 TTGGAGCAGCACAGGGAGGTGGG - Intronic
1143205056 17:5135546-5135568 TTGGAGCAGCCCCAGGAGGAGGG - Intronic
1143513163 17:7406746-7406768 TCAGAGCAGCAACTGTAGGGGGG + Intronic
1145796535 17:27658765-27658787 TTGGAGCAGCAGCTGGGTGGGGG + Intergenic
1145904918 17:28511018-28511040 TAGCCCCAGCACCTGGAGGAAGG + Intronic
1146058378 17:29592328-29592350 TTGGACCAGTCCCTGGAGGGAGG - Intronic
1146313993 17:31792964-31792986 GAGTAGAAGCACCTGGTGGGGGG - Intergenic
1146832437 17:36081644-36081666 GAGAAGCAGGACTTGGAGGGTGG - Intergenic
1146846919 17:36187962-36187984 GAGAAGCAGGACTTGGAGGGTGG - Intronic
1147596675 17:41722490-41722512 TAGCAGCAGCTCCTAGAGGGCGG - Intronic
1148693455 17:49545804-49545826 TAGGAGCAGAACCGGGGGTGAGG + Intergenic
1149133698 17:53340017-53340039 TGGGTGCAGCCCATGGAGGGTGG + Intergenic
1149990209 17:61379012-61379034 TTGGGGCAGCACCTGGAGAGGGG - Intronic
1150433440 17:65137180-65137202 GAGGAGGAGGACCTGGCGGGAGG - Intergenic
1150898403 17:69240310-69240332 TAGGAGCAGATCCTGGAATGGGG + Intronic
1153935583 18:9917791-9917813 TAGAAGCAGCACGGGGCGGGGGG + Intronic
1154389502 18:13924285-13924307 TTGTAGCAGCACCTGGGGGAAGG - Intergenic
1156626955 18:38920563-38920585 TAGGTGCAGCCCATGGAGGGTGG - Intergenic
1156967865 18:43117667-43117689 TAAAAGTAGGACCTGGAGGGTGG - Intergenic
1157643175 18:49238910-49238932 GAGGGGCAGCATTTGGAGGGTGG - Intronic
1158842682 18:61405230-61405252 TAGCAGCAGCTCCTGGTTGGGGG - Intronic
1160432052 18:78819264-78819286 GAGGATGAGCCCCTGGAGGGTGG + Intergenic
1160621093 18:80171235-80171257 CAGGAGGAGGACTTGGAGGGAGG - Exonic
1160918355 19:1508229-1508251 GAGGAGCAGGACCTGGCGGGAGG + Intronic
1161021057 19:2011747-2011769 GAGGAGCAGGAGCAGGAGGGTGG - Intronic
1161279047 19:3435173-3435195 TAGCAGCCGCAACTGGACGGAGG + Exonic
1161455047 19:4365854-4365876 GAGGAGCAGCCCTTGGAAGGAGG - Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161818838 19:6516761-6516783 CAGGAGCCGCACCTGCCGGGTGG + Intergenic
1162341465 19:10093763-10093785 TGTGAGCAGCAACTGGAGGGTGG - Exonic
1162921678 19:13906623-13906645 TTGGAGCCTCACCTGGGGGGAGG - Intronic
1163013538 19:14440312-14440334 TCGGAGCAGGAGCTGGAGGTGGG + Exonic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163700503 19:18784442-18784464 TGGGAGCAGCAGGTGGTGGGCGG + Intronic
1163847821 19:19647162-19647184 CAGCAGCAGCCCCTGTAGGGTGG + Exonic
1163866580 19:19778020-19778042 TATGAGAGGGACCTGGAGGGAGG + Intergenic
1163894952 19:20050789-20050811 TATGAGAGGGACCTGGAGGGAGG - Intergenic
1164998921 19:32744771-32744793 GAGGAGGAGCACCGGGTGGGAGG - Intronic
1165370466 19:35402481-35402503 TAGGGGCAGCAGCTGGTGGAGGG + Intergenic
1166054283 19:40279335-40279357 TGGGAGCAGGACCAGGAGGGAGG - Intronic
1166318671 19:42003236-42003258 TGGGAGCCATACCTGGAGGGTGG - Intronic
1166645602 19:44529577-44529599 GAGGGGCTGCACCTGGAGTGAGG - Intronic
1166914163 19:46183269-46183291 CAGGAGAAGGACCTGGTGGGAGG - Intergenic
1167254553 19:48419425-48419447 TCCCAGCAGCCCCTGGAGGGGGG + Intronic
1167572530 19:50298026-50298048 CATGTGCAGTACCTGGAGGGTGG - Intronic
1168083807 19:54030064-54030086 CAGGAGCGCCACCTGGAGGTAGG + Intergenic
1168428200 19:56256711-56256733 TAGGGGCAGCCCCTGGTGGCAGG + Intronic
1168627265 19:57929305-57929327 GAGGAGTGGCACCTGGTGGGAGG - Intronic
925149697 2:1606638-1606660 TGGGAGGTCCACCTGGAGGGAGG + Intergenic
925289849 2:2740231-2740253 TAGGAGCACCTGCTGGAGAGAGG + Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
927559415 2:24059359-24059381 CTGGACCAGCACCTGGGGGGGGG + Intronic
928576800 2:32663477-32663499 TGGGTGCAGCCCATGGAGGGCGG - Intronic
929582055 2:43087595-43087617 TTGGTACAGCACCTGGAGTGTGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
931287236 2:60842898-60842920 CAGGAGCAGCCCCTGAAGGCTGG + Intergenic
931331114 2:61285184-61285206 TAAGAGCAGCAACTGTAGGCTGG + Intronic
932217332 2:69975397-69975419 GAGGAGCAGCACCGGCAGGGAGG - Intergenic
934903187 2:98177066-98177088 CTGGAGCTGAACCTGGAGGGTGG + Intronic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935489490 2:103698820-103698842 TAGGAGCTGCACAGGGTGGGCGG - Intergenic
936741044 2:115509026-115509048 TGGGAGCAGCACAAGGAAGGGGG + Intronic
938317414 2:130339762-130339784 GAGGAGCAACACCTGGGGGCAGG - Intronic
939101331 2:137897835-137897857 GAGAAGCAGCAGCTGGAGGTTGG - Intergenic
940089153 2:149896746-149896768 CAGCAGCAGCACCTGGGAGGAGG + Intergenic
942318460 2:174715197-174715219 TAGGAGGTGCAACTGGAGGTGGG + Intergenic
943000842 2:182326816-182326838 TAGGATCAGAGACTGGAGGGAGG + Intronic
943687060 2:190829755-190829777 TAGGAGCAGGAGCAAGAGGGTGG + Intergenic
946065407 2:216983008-216983030 TGGGTGCAGCCCATGGAGGGCGG - Intergenic
946305913 2:218857036-218857058 AAGGAGCAGGAGCTGGAGAGGGG - Intergenic
946765421 2:223036002-223036024 TTGGAGGAGAAGCTGGAGGGTGG - Intergenic
946921268 2:224584695-224584717 AAGGAGCAGCTCCCGGACGGGGG + Intronic
948021541 2:234737632-234737654 TAGGAGTAACTTCTGGAGGGAGG - Intergenic
948080016 2:235198293-235198315 CTGGAGCTGCACCTGCAGGGTGG + Intergenic
948217716 2:236244244-236244266 TATGAGCAGAGGCTGGAGGGAGG + Intronic
948278647 2:236729360-236729382 AAGGAGCTGCAGCTGGTGGGCGG + Intergenic
948505805 2:238426574-238426596 CACGAGCAGCCCCGGGAGGGTGG - Intergenic
948805635 2:240452606-240452628 CAGGAGCAGCACCCGCAGGCGGG + Intronic
1169745574 20:8939211-8939233 TGAGAGCAGCACCAGGAGGATGG + Intronic
1169859970 20:10141084-10141106 TAAGGGCAGCACGTGGAGTGAGG - Intergenic
1170330198 20:15201043-15201065 CAGCAGCAGCACCTGGGAGGTGG - Intronic
1170627321 20:18039834-18039856 TGGGAGCCCCATCTGGAGGGAGG + Intronic
1172450618 20:35020159-35020181 TAGGACCAGCACATTGATGGTGG - Intronic
1173281046 20:41628126-41628148 TAGGGGAAGGACCTGGTGGGAGG - Intergenic
1173595112 20:44253923-44253945 TGGGAGCGGCCCCTGGAGGCAGG + Intronic
1174117098 20:48233956-48233978 TTGGAGGAGAACCTGGTGGGAGG - Intergenic
1174943290 20:54956115-54956137 CAGGAGAAGCACCTGGAGTTCGG - Intergenic
1175699493 20:61126721-61126743 TCTGGGCAGGACCTGGAGGGTGG + Intergenic
1176423207 21:6532707-6532729 GAGCAGCTGCACCTGGAGGTGGG - Intergenic
1177198421 21:17927606-17927628 TAATAGCAGCAGCTGTAGGGTGG + Intronic
1179656548 21:42849508-42849530 CAGGAGCTGCTCCTGGAGAGTGG - Exonic
1179676560 21:42986954-42986976 TAGGCGCGGCACCTGGTGAGGGG + Intronic
1179698700 21:43141023-43141045 GAGCAGCTGCACCTGGAGGTGGG - Intergenic
1182522419 22:30892002-30892024 AAGAAGCAGCAGCTGGAGGGCGG + Intronic
1183099590 22:35575609-35575631 TGGGAGCTGCACCTTGTGGGTGG + Intergenic
1183539741 22:38423144-38423166 GAGGAGCGGCACGAGGAGGGAGG + Intergenic
1183602399 22:38847553-38847575 TTGGAGAAGCACCTGGAGGGAGG - Intergenic
1184095624 22:42314785-42314807 CTGGAGCAGCATCTGGAGAGGGG + Intronic
1184445511 22:44544757-44544779 TAGGGGGAGCCCCTGGAGGAGGG - Intergenic
1184746428 22:46458730-46458752 CAGGTGCAGCACCAGGCGGGCGG - Intronic
1185044814 22:48523566-48523588 TAGGAGCAGCACCTGGGATGTGG - Intronic
949219024 3:1607217-1607239 GAGGAGGAGGAGCTGGAGGGAGG + Intergenic
949390413 3:3556195-3556217 TAGGAGCAGTAGCTGGAAGGAGG + Intergenic
952843502 3:37667816-37667838 CAGGAGAAACACCTGGTGGGAGG + Intronic
954386352 3:50246101-50246123 GGGGAGCAGCACCTGGAGGAAGG + Intronic
954667207 3:52262483-52262505 CATCAGCATCACCTGGAGGGTGG + Intronic
954692670 3:52403977-52403999 TAGGGTCAGCCCCTGGAGGTCGG - Intronic
955096315 3:55801673-55801695 CAGGAGCATCACCTGGAAGTAGG + Intronic
956339883 3:68210666-68210688 TAGTAGCAGCAACAGTAGGGTGG - Intronic
956665373 3:71637287-71637309 AAGGGGCAGCCCCTGGAGGAAGG + Intergenic
957746201 3:84346763-84346785 TTGGAGGAGGACCTGGTGGGAGG - Intergenic
961150150 3:124631126-124631148 TAGGAGTAAAACCAGGAGGGTGG - Intronic
962352366 3:134665265-134665287 CAGGGGCAGCACCAGGAGGTAGG - Intronic
962702080 3:138009904-138009926 GAGGAGCCGGAGCTGGAGGGAGG + Intronic
963123345 3:141794307-141794329 TGGCACCAGCAGCTGGAGGGTGG + Intronic
967827988 3:193894218-193894240 ATGGGGCAGCATCTGGAGGGAGG - Intergenic
968007985 3:195255937-195255959 TATGGGCAGCTCCTGGAGGAGGG + Intronic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968446259 4:653841-653863 CCACAGCAGCACCTGGAGGGAGG - Exonic
968473624 4:792741-792763 TGGGAGGAGCGGCTGGAGGGTGG - Intronic
968517194 4:1020395-1020417 TGGGAGCAGCACGTGGGGAGTGG + Intronic
968940629 4:3635660-3635682 TGGGACCAGCATCTGAAGGGCGG - Intergenic
969251581 4:5971881-5971903 GAGGAGCAGCCCTTGGAAGGTGG + Intronic
969474330 4:7412699-7412721 GAGGAGCAAGACCTGCAGGGAGG - Intronic
969589042 4:8110834-8110856 TAGGAGCGGCACCTGCATGGAGG - Intronic
969910562 4:10441558-10441580 CAGGAATAGCCCCTGGAGGGAGG + Exonic
970604402 4:17665896-17665918 AAGAAGCAGCAACTGGGGGGCGG - Intronic
970744684 4:19280913-19280935 TAGGGGAAGGACCTGGTGGGAGG - Intergenic
971714186 4:30153831-30153853 TTGGAGCAGAACCAGGAGTGGGG + Intergenic
973562562 4:52151329-52151351 TAGATGCAGCCCATGGAGGGTGG + Intergenic
977002825 4:91524997-91525019 TAAGTGCAGAACCTGGAGAGTGG + Intronic
977076888 4:92464863-92464885 TAGGGGAAGGACCTGGTGGGAGG + Intronic
977426835 4:96877009-96877031 TAGAAGTAGAACCTGGTGGGAGG - Intergenic
978493973 4:109339737-109339759 TGGGTGCAGCCCATGGAGGGTGG + Intergenic
985805162 5:2038491-2038513 CAGGGGCGGTACCTGGAGGGAGG - Intergenic
987317347 5:16735973-16735995 TAGCAGCAGTACCTGGAAAGGGG - Intronic
991432332 5:66561475-66561497 CAGGGGCAACAACTGGAGGGTGG - Intergenic
993031287 5:82708712-82708734 TAGGAGCAACACGAGGAGAGTGG - Intergenic
993333135 5:86624237-86624259 CAGGAGGATCCCCTGGAGGGTGG - Intergenic
993659173 5:90609199-90609221 TAGGAGCAGCATATGGCTGGTGG + Intronic
993943387 5:94089063-94089085 TAACAGCAGCCACTGGAGGGAGG + Intronic
994729585 5:103476170-103476192 TAGGAGCTGAACCTGGGGTGTGG + Intergenic
997397396 5:133574444-133574466 TAAGAGCAGTACCTGCAGGAAGG - Intronic
997865236 5:137456214-137456236 TAGGAGAAGCAACTGAGGGGCGG - Intronic
998445020 5:142191805-142191827 TTGGAGCCTCACCTTGAGGGTGG + Intergenic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1002701573 5:181128547-181128569 TGGGAGCAGCTCCAGGAGGCAGG - Intergenic
1002989791 6:2228043-2228065 TAGGTTCAGCACTGGGAGGGAGG - Intronic
1003398529 6:5773141-5773163 CAGGAGCAGGACCAAGAGGGTGG - Intergenic
1003422260 6:5969063-5969085 AAGGACCAGCACAGGGAGGGAGG + Intergenic
1003714901 6:8635426-8635448 CAAGAGCAGGACCTGGTGGGAGG + Intergenic
1004636105 6:17469257-17469279 GAAGAGAAGCACCCGGAGGGTGG + Intronic
1006866984 6:37216555-37216577 TGGGATGAGCACCTGGATGGAGG + Intronic
1008984912 6:57530673-57530695 TAGGAGGAGGACTTGCAGGGAGG + Intronic
1012525009 6:100166875-100166897 CAGGAGCAGCACCAGGAATGTGG - Intergenic
1013373464 6:109490904-109490926 TTGGGGCAGCAGCTGGAGGATGG + Intergenic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1015075387 6:129150415-129150437 TGGGAGCAGCACTTGAAGGTAGG + Intronic
1015517670 6:134100453-134100475 TAGGAGTAGCCTCTGCAGGGAGG + Intergenic
1017494939 6:154975349-154975371 AAGGAGAAACACCTGGAGGGAGG + Intronic
1017811819 6:157989224-157989246 TTGGATCAGCACCTGGTAGGTGG - Intronic
1017812883 6:157996769-157996791 CAGGAGCAGGACCAAGAGGGTGG - Intronic
1018996990 6:168717459-168717481 AAGGAGCAGCACCTGGAAGGAGG + Intergenic
1019357322 7:587482-587504 TAGGCGCAGGCCCTGGAGGCGGG - Intronic
1019395591 7:816360-816382 TGGGGGCTGCACCTGGAGGAGGG - Intergenic
1019599540 7:1874376-1874398 TTGCAGCAGCACCGGGACGGGGG + Intronic
1019704293 7:2490140-2490162 TGGGAGCAGCAGTTGGAGCGGGG - Intergenic
1019828764 7:3304930-3304952 CATGAGAATCACCTGGAGGGAGG - Intronic
1020926638 7:14335904-14335926 TGGGAATAGCACCTGGTGGGTGG - Intronic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1024028832 7:45438449-45438471 TAGTATCAGCAGGTGGAGGGAGG - Intergenic
1024837682 7:53542711-53542733 TAGGAGCTGCACCAGGAGCAAGG + Intergenic
1024912763 7:54465018-54465040 TAGGATGATCACCTGGAGGGAGG - Intergenic
1026760626 7:73123268-73123290 TAAGAGCAGCCCCTGGGGGAGGG - Intergenic
1027036970 7:74932089-74932111 TAAGAGCAGCCCCTGGGGGAGGG - Intergenic
1027086594 7:75269370-75269392 TAAGAGCAGCCCCTGGGGGAGGG + Intergenic
1029392894 7:100287373-100287395 TAAGAGCAGCCCCTGGGGGAGGG + Intergenic
1030645244 7:112053869-112053891 TAGGAGCTGTTCCTGGAAGGGGG + Intronic
1030708547 7:112721401-112721423 TTGGAGGAGAACATGGAGGGAGG - Intergenic
1030947366 7:115740349-115740371 TAAGAGAAGTACCTGGAGGATGG + Intergenic
1033524742 7:142199506-142199528 TAGGATCAGATCCTGGAGGGTGG + Intronic
1035418023 7:158705360-158705382 TAGGGGCCGCACCTGGCCGGAGG - Intergenic
1035431045 7:158821995-158822017 TAGAAGAAGCACCTGGGAGGCGG - Intronic
1035433217 7:158838056-158838078 GAGGAGCAGGACCTAGAGAGAGG + Intergenic
1035625431 8:1067384-1067406 TAGGAGCATCACCTGGTGCCTGG + Intergenic
1036478945 8:9120651-9120673 TATGAGCAGAGCCTGGAGGTGGG + Intergenic
1037828914 8:22176950-22176972 TAGGAGCAGCACCTGGAGGGCGG - Exonic
1039593909 8:38774044-38774066 GAAGAGCAGCTGCTGGAGGGAGG - Intronic
1041909811 8:63077316-63077338 TGGGTGCAGCCCATGGAGGGTGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1048937041 8:139366027-139366049 AAGGAGCAGCACCGTGAGGGAGG + Intergenic
1049100767 8:140577596-140577618 GAGGAGGAGCAGCTGGAGGGAGG + Intronic
1049324278 8:142013975-142013997 GCGGACCAGCACCTGGAGGGTGG - Intergenic
1049358405 8:142200011-142200033 TAGAGGCAGAACCTGGAGGCAGG + Intergenic
1049425662 8:142536899-142536921 GATGAGCAGCACCTGTGGGGGGG - Intronic
1049443212 8:142618541-142618563 TATGGGCACCACCTGTAGGGTGG - Intergenic
1049445968 8:142631708-142631730 GAGAAGCAGAACCGGGAGGGGGG + Intergenic
1049579530 8:143405012-143405034 TAGGGGCAGCAGCGAGAGGGAGG - Intergenic
1051122477 9:13766284-13766306 TAGGAGCAACACCTGTAGGAAGG + Intergenic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1053569322 9:39288023-39288045 AAGCAGCAGCACCTTGAGGACGG + Exonic
1053835279 9:42129053-42129075 AAGCAGCAGCACCTTGAGGACGG + Exonic
1054090954 9:60847007-60847029 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054112365 9:61122563-61122585 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054127820 9:61330987-61331009 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1054595345 9:67059578-67059600 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1057181808 9:93034652-93034674 CAGGTGCTGCACCTGCAGGGAGG + Exonic
1057798162 9:98172735-98172757 TAGGTGGAGCTCCTGGAGGCTGG - Exonic
1058130482 9:101247193-101247215 GAGCAGCAGCTCCTGGAAGGAGG + Intronic
1058720970 9:107763404-107763426 TGGGAGCAGGAGTTGGAGGGAGG - Intergenic
1058823680 9:108755618-108755640 CAGCAGCATCACCTGGAGGCTGG + Intergenic
1058939069 9:109796808-109796830 CAGGGGCAGAACCTGGTGGGAGG - Intronic
1059344265 9:113617317-113617339 TGGCAGCAGCCCCTGGAGGTAGG + Intergenic
1059423291 9:114205907-114205929 AAGGAGCTGCACCTGCTGGGTGG + Intronic
1059692540 9:116699366-116699388 AATGAGCACCACCTGGAGGGTGG + Exonic
1060735079 9:126061631-126061653 TCGGAGCTGCCCCTGGAGGAGGG - Intergenic
1060895874 9:127216948-127216970 GAGGTGGACCACCTGGAGGGCGG + Intronic
1061062461 9:128257514-128257536 CAGCAGCTTCACCTGGAGGGAGG + Exonic
1061161269 9:128895723-128895745 GAGGAGCAGCAGCTGGTAGGAGG + Intronic
1062109255 9:134773055-134773077 CATGGGCAGCAACTGGAGGGTGG - Intronic
1062586538 9:137252261-137252283 TAGGCTCAGCACCTGTAAGGAGG + Intronic
1185668665 X:1788242-1788264 TAGGTGCAGGACCTTGAGGTTGG - Intergenic
1186125488 X:6409418-6409440 TAGGAGCCGCTCCTAGAGGAAGG - Intergenic
1186393991 X:9189457-9189479 TGAGAGCAGCAGCTGGAGGAGGG - Intergenic
1186393997 X:9189504-9189526 TAAGAGCAGCAGCTGGAGGAAGG - Intergenic
1186852406 X:13593364-13593386 TAGGAGCAGAGCCTGAAAGGGGG + Intronic
1188451035 X:30308524-30308546 CAGGGGCAGCACCTGGAAGCAGG + Exonic
1189377188 X:40475142-40475164 TAGGATCAGCACCTGGGGAAGGG + Intergenic
1189535433 X:41930054-41930076 TAGGACAAGCAATTGGAGGGAGG - Intergenic
1190368430 X:49719179-49719201 TAGGAGCTTCCCCTGGAGGGAGG + Intergenic
1190966806 X:55308551-55308573 TAGATGCAGCACCTGGCCGGTGG + Intergenic
1192772013 X:74203014-74203036 TAGCAGCAGCACCTCAAAGGTGG - Intergenic
1193030532 X:76893316-76893338 TAAGAGAAGGACCTGGTGGGAGG - Intergenic
1197435249 X:126420094-126420116 CAGGAGGATCACCTGGAGGCAGG - Intergenic
1197551665 X:127899827-127899849 TAGGAGAGGGACCTGGTGGGAGG + Intergenic
1200054897 X:153455237-153455259 CAGGAACAGCACCTGGAGGCTGG + Intronic
1200118234 X:153778576-153778598 TGGGGGCACCACGTGGAGGGGGG - Intronic
1200316611 X:155139289-155139311 TAGGAGCAGTAGCTGGGTGGTGG + Intronic