ID: 1037828915

View in Genome Browser
Species Human (GRCh38)
Location 8:22176953-22176975
Sequence ACGTAGGAGCAGCACCTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828915_1037828926 3 Left 1037828915 8:22176953-22176975 CCCTCCAGGTGCTGCTCCTACGT 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1037828926 8:22176979-22177001 TCGCCGCGGCGGGGGCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218
1037828915_1037828921 -8 Left 1037828915 8:22176953-22176975 CCCTCCAGGTGCTGCTCCTACGT 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828915_1037828923 -7 Left 1037828915 8:22176953-22176975 CCCTCCAGGTGCTGCTCCTACGT 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828915_1037828928 16 Left 1037828915 8:22176953-22176975 CCCTCCAGGTGCTGCTCCTACGT 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1037828928 8:22176992-22177014 GGCCCCCAGGCCATCTCCATCGG 0: 1
1: 0
2: 2
3: 13
4: 184
1037828915_1037828925 -5 Left 1037828915 8:22176953-22176975 CCCTCCAGGTGCTGCTCCTACGT 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828915_1037828924 -6 Left 1037828915 8:22176953-22176975 CCCTCCAGGTGCTGCTCCTACGT 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828915 Original CRISPR ACGTAGGAGCAGCACCTGGA GGG (reversed) Exonic
901055772 1:6448116-6448138 AGGTAGGAGCAGCCCCCGGACGG + Intronic
902478621 1:16700522-16700544 AGGTTGGAGCAGCCCCTAGACGG - Intergenic
904268518 1:29332442-29332464 AAGGAGGACCAGAACCTGGAAGG - Intergenic
907587403 1:55633408-55633430 AGGTAAGAGCAGGACCTTGAGGG - Intergenic
910426664 1:87125708-87125730 ATGAAGGAGAAGCCCCTGGAAGG - Intronic
915244071 1:154543968-154543990 CCTCAGGAGCAGCACCAGGAAGG - Exonic
915910903 1:159914712-159914734 AAGTGAGGGCAGCACCTGGAAGG + Intergenic
916093224 1:161325582-161325604 AGGTAGAAGGATCACCTGGATGG + Intronic
917402348 1:174664619-174664641 ATCTAAGAGGAGCACCTGGAAGG - Intronic
922695743 1:227730019-227730041 ACGTGGGAGCTGCACATAGATGG - Intronic
1064295803 10:14078257-14078279 AAGTAGGAGAAGAACCTGGAGGG + Intronic
1064758658 10:18596244-18596266 ACTTGTGTGCAGCACCTGGAGGG - Exonic
1068044742 10:51871755-51871777 ATGTAGGTCCAACACCTGGAGGG + Intronic
1075888742 10:125927003-125927025 AGGTAAGAGCAGCAACTAGAAGG - Intronic
1076070740 10:127486420-127486442 ACTCAGGACCAACACCTGGAAGG - Intergenic
1076403342 10:130197308-130197330 AGGGGGGAGCAGCACCTGGCAGG + Intergenic
1077363872 11:2153666-2153688 AGGGAGGAGCAGCTCCTCGAGGG - Intronic
1081897360 11:46598028-46598050 ACGTAGGAGCAGCCCAGGGAAGG + Intergenic
1085011046 11:73142073-73142095 ACGAGGGAGGAGCACCGGGAAGG + Exonic
1085170193 11:74443283-74443305 ACATAGGAGCAGCCACAGGAGGG - Intergenic
1085766721 11:79289625-79289647 TCTTAGGATCAGCACCTGTAAGG - Intronic
1091375588 12:22847-22869 AAGAGGGAGCAGCAGCTGGAGGG + Intergenic
1096941773 12:55355053-55355075 CAGTAGGAGCAGCCCATGGAGGG + Intergenic
1099528794 12:83748912-83748934 AAATGTGAGCAGCACCTGGAAGG + Intergenic
1103886554 12:124206772-124206794 ACATAGGAGACGCTCCTGGAAGG + Intronic
1104443928 12:128818531-128818553 ATGAAGCAGCCGCACCTGGAGGG + Intronic
1105752781 13:23436834-23436856 CGGTAGGAGCAGCAGCTGGGAGG - Intergenic
1108002143 13:45913819-45913841 AGGTGGGAGGATCACCTGGAGGG - Intergenic
1108255126 13:48602434-48602456 ATGCATGAGAAGCACCTGGAGGG - Intergenic
1108383727 13:49879213-49879235 ACGTGGGAGCAGCGCATGGAGGG + Intergenic
1112796698 13:103065014-103065036 ACGTTGCATTAGCACCTGGATGG + Intronic
1118785591 14:69043120-69043142 ACGGAGTGGCAGCAGCTGGAGGG - Intergenic
1119568575 14:75649855-75649877 AGGAGGGAGCAGCAACTGGAAGG - Exonic
1120051506 14:79872259-79872281 ACGTGTGAGAATCACCTGGAGGG + Intergenic
1121436239 14:93922040-93922062 AGGTAGGAGAAGCACCTGGGAGG - Intronic
1121944446 14:98105391-98105413 AGGTAGGAGAGGCCCCTGGAGGG + Intergenic
1125386239 15:39140046-39140068 GCATAGGAGCAGCCCCAGGAGGG + Intergenic
1134441362 16:14301573-14301595 AAGTAGGAGCAGCATCAGGCAGG - Intergenic
1136645143 16:31607901-31607923 ACACAGGAGCAGCACCAAGATGG + Intergenic
1137395987 16:48116548-48116570 AGGTAGGAGCATGGCCTGGAAGG + Intronic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1139415885 16:66809797-66809819 ACGTAGGAGCAGTAGCTACAGGG + Intronic
1141289887 16:82708026-82708048 ACGTCTGAGCAACAGCTGGAAGG - Intronic
1141437678 16:84009733-84009755 ACGTAGGGTCAGCCCCCGGAGGG + Intronic
1144674416 17:17152815-17152837 AGGAAGGAGCAGCACCTGGGAGG + Intronic
1149561081 17:57608406-57608428 AAGTGGGAGCTGCACATGGAGGG + Intronic
1157422628 18:47559324-47559346 ACGAGAGAGCAGCATCTGGAAGG - Intergenic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1158737941 18:60105047-60105069 AGGTAGCAGCATCACCTGAAGGG - Intergenic
1160151588 18:76399124-76399146 GCGTAGCACCAGCACCAGGAGGG - Intronic
1160918354 19:1508226-1508248 AGGGAGGAGCAGGACCTGGCGGG + Intronic
1161933138 19:7354544-7354566 ACGAGGGGGCAGCACCTGCACGG + Intronic
1162026988 19:7900047-7900069 TTGGAGGAGCTGCACCTGGAGGG + Exonic
1162540674 19:11294067-11294089 ACGTGGGAGCAGCTCCTGGAAGG - Intergenic
1163632512 19:18424609-18424631 TGGGGGGAGCAGCACCTGGAGGG + Intronic
1165321612 19:35088870-35088892 GCCTAGGAGGAGAACCTGGAAGG - Intergenic
1202712640 1_KI270714v1_random:26353-26375 AGGTTGGAGCAGCCCCTAGACGG - Intergenic
925553683 2:5104987-5105009 AAGCAGGAGCACCAGCTGGAGGG + Intergenic
926166483 2:10524433-10524455 GTGGAGGAGCAGCAGCTGGAGGG + Intergenic
927156932 2:20225887-20225909 TCGAAGGAGCAGCAACTGCACGG - Intergenic
928306334 2:30172966-30172988 ATGTAGCAGAAGGACCTGGAAGG - Intergenic
935707575 2:105870211-105870233 GGGTAGGAGGAGCACCTGTAGGG - Intronic
936381917 2:111993951-111993973 ACGTAGCAGATGCACCCGGACGG - Intronic
937364192 2:121249023-121249045 ACGGAGCACCAGCAGCTGGAGGG - Exonic
937949934 2:127376573-127376595 ACATGGGAGCAGCCCCTGTACGG - Intronic
937964115 2:127488112-127488134 GCGTTGGAGCAGAGCCTGGAGGG - Intronic
941887423 2:170542714-170542736 ATGTAGGAGCAACACCTAGTAGG + Intronic
946057151 2:216912330-216912352 ACTCAGCATCAGCACCTGGAGGG + Intergenic
946422903 2:219575000-219575022 GCGCAGCAGCAGCACCAGGACGG - Exonic
947118285 2:226794784-226794806 ATGTAGGAGCAGCCACAGGAGGG - Intronic
947463912 2:230324904-230324926 ACGAAGGCCCATCACCTGGATGG + Intergenic
1172697662 20:36833550-36833572 ACGAAAGAGCAGCTCCTGGCCGG + Intronic
1174447164 20:50597921-50597943 AGGTAGGAGCAGAATCTTGAGGG + Intronic
1178361790 21:31954684-31954706 ACGCATCAGAAGCACCTGGAGGG + Intronic
1178772703 21:35520559-35520581 ACGTAGCAGTGGCACATGGATGG + Intronic
1182926009 22:34126066-34126088 ATGTATGAGAATCACCTGGAGGG + Intergenic
1184772812 22:46607816-46607838 ACGAGGGAGCAGCACATGCAGGG - Intronic
954638428 3:52084250-52084272 GAGGAGGAGCAGCTCCTGGAAGG - Intronic
956609291 3:71106055-71106077 AGGTAGTAACAGCACCAGGATGG - Intronic
960028618 3:113035724-113035746 AGGTACTAGCAGCACCGGGATGG + Intergenic
960579751 3:119267030-119267052 CAGTAGGTGCAGCACATGGAGGG + Intergenic
961558582 3:127713415-127713437 ACCTGGGAGCAGCGCCTGCAAGG - Intronic
968165359 3:196460382-196460404 AGGTAGCAGCAGCAGCTGGGAGG + Intergenic
969589043 4:8110837-8110859 CTGTAGGAGCGGCACCTGCATGG - Intronic
972548650 4:40106989-40107011 ACTTAGGAGAAGCACATGAATGG + Exonic
974134271 4:57795051-57795073 ATGTAGATGCAGCACCTGAAAGG - Intergenic
975602464 4:76116799-76116821 AGGTAGTAGCCGCACCTGGAAGG - Intronic
975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG + Intergenic
982216620 4:153088001-153088023 ATGTAGAAGCAGCACCAAGAGGG + Intergenic
982909307 4:161118560-161118582 CAGTAGGAGCAGCCCATGGAGGG - Intergenic
986127139 5:4893552-4893574 ACGTGGGTGCAGCCCATGGAGGG - Intergenic
986725072 5:10589245-10589267 TCGAAGGAGCAGGTCCTGGATGG + Intronic
990272966 5:54165509-54165531 ACATTGGAGCAGCATCTGAAAGG - Intronic
994755136 5:103786018-103786040 ATGTAGGAGCATCACATGGCAGG + Intergenic
996337606 5:122401783-122401805 ACATTTGAGCAGCACCTGGCTGG - Intronic
997613178 5:135229347-135229369 GCGTATGGGCAGGACCTGGAAGG + Intronic
997727536 5:136133735-136133757 ACGTAGTAACAGCAGCTGAAAGG - Intronic
1000527400 5:162374898-162374920 ATGTAGGAGCAGAACATGTAGGG - Intergenic
1001168901 5:169398161-169398183 ACCTAGGATTAGGACCTGGAAGG + Intergenic
1004676977 6:17852511-17852533 AGGTAGGAGAATCACCTGGGCGG - Intronic
1005058860 6:21757654-21757676 ACGCAGGAGAATCACCTGGGAGG - Intergenic
1005795688 6:29359631-29359653 AAGCAGGTGCAGCACCTGGAGGG + Intronic
1006125389 6:31834622-31834644 GCTTAGGAGCAGCACCCGGCTGG + Exonic
1006199871 6:32279038-32279060 AAGTAGGTGCAGCTCATGGAGGG + Intergenic
1006415014 6:33898413-33898435 AAGGAGGAGCAGCCCCTTGAGGG - Intergenic
1017143918 6:151216731-151216753 AGGTAGGTGCAGATCCTGGAGGG + Intergenic
1018996989 6:168717456-168717478 GAGAAGGAGCAGCACCTGGAAGG + Intergenic
1019599537 7:1874373-1874395 ACGTTGCAGCAGCACCGGGACGG + Intronic
1019865849 7:3709371-3709393 AAGTAGGAGCAGCAGAAGGAAGG - Intronic
1024547600 7:50535514-50535536 GCGAAGGAGGAGCACGTGGAGGG + Intronic
1026923741 7:74174559-74174581 GCCTAGGAGCGGCGCCTGGAGGG + Intronic
1031555968 7:123176778-123176800 AGGTAGGAGGAGAACCAGGAGGG - Intronic
1034202186 7:149289620-149289642 AGGAAGGAGAAGCACGTGGAAGG + Intronic
1037828915 8:22176953-22176975 ACGTAGGAGCAGCACCTGGAGGG - Exonic
1038254846 8:25941759-25941781 GAGGAGGAGCAGCACCTGTAGGG - Intronic
1041838419 8:62242550-62242572 ACGTAGGTGCAGCTCATGGAAGG - Intergenic
1045249936 8:100474760-100474782 AAGTCTGAGCAGAACCTGGAAGG + Intergenic
1049337348 8:142093508-142093530 ACGAGGGAGCAGGTCCTGGAGGG + Intergenic
1049871726 8:144984332-144984354 ACATAGCAGCAGCATTTGGAGGG - Intergenic
1050781405 9:9341345-9341367 ACGTTGGAGCAACAACTGAATGG - Intronic
1059195207 9:112364978-112365000 ACGTAGAAGCAGCAAATAGAAGG - Intergenic
1060658572 9:125389255-125389277 ACAGAGGGGCAGCACGTGGAAGG - Intergenic
1060782309 9:126421887-126421909 AGGCAGGAACAGCACCCGGACGG + Exonic
1061965010 9:134008464-134008486 AGGCAGGAGGACCACCTGGAGGG - Intergenic
1193109516 X:77713550-77713572 TAGTAGGAGCCTCACCTGGATGG - Intronic
1195266719 X:103188643-103188665 ACCTCAGAGCAGCACCTTGAAGG + Intergenic
1195524262 X:105868414-105868436 ATGTAGGAGGAGTACGTGGAGGG - Intronic
1196707540 X:118728534-118728556 CCTTAGGAGCAGCTCCTGGAAGG + Intronic
1197768566 X:130074598-130074620 ACGCAGGATCAGATCCTGGAAGG - Exonic
1201582161 Y:15521038-15521060 AGTTAGCAGCAGCACCAGGAAGG + Intergenic