ID: 1037828916

View in Genome Browser
Species Human (GRCh38)
Location 8:22176954-22176976
Sequence CACGTAGGAGCAGCACCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828916_1037828924 -7 Left 1037828916 8:22176954-22176976 CCTCCAGGTGCTGCTCCTACGTG 0: 1
1: 0
2: 2
3: 10
4: 131
Right 1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1037828916_1037828923 -8 Left 1037828916 8:22176954-22176976 CCTCCAGGTGCTGCTCCTACGTG 0: 1
1: 0
2: 2
3: 10
4: 131
Right 1037828923 8:22176969-22176991 CCTACGTGGGTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 169
1037828916_1037828925 -6 Left 1037828916 8:22176954-22176976 CCTCCAGGTGCTGCTCCTACGTG 0: 1
1: 0
2: 2
3: 10
4: 131
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828916_1037828928 15 Left 1037828916 8:22176954-22176976 CCTCCAGGTGCTGCTCCTACGTG 0: 1
1: 0
2: 2
3: 10
4: 131
Right 1037828928 8:22176992-22177014 GGCCCCCAGGCCATCTCCATCGG 0: 1
1: 0
2: 2
3: 13
4: 184
1037828916_1037828921 -9 Left 1037828916 8:22176954-22176976 CCTCCAGGTGCTGCTCCTACGTG 0: 1
1: 0
2: 2
3: 10
4: 131
Right 1037828921 8:22176968-22176990 TCCTACGTGGGTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1037828916_1037828926 2 Left 1037828916 8:22176954-22176976 CCTCCAGGTGCTGCTCCTACGTG 0: 1
1: 0
2: 2
3: 10
4: 131
Right 1037828926 8:22176979-22177001 TCGCCGCGGCGGGGGCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828916 Original CRISPR CACGTAGGAGCAGCACCTGG AGG (reversed) Exonic
900335347 1:2160444-2160466 CACGTAGGAGGGGCTCATGGGGG + Intronic
915476467 1:156155568-156155590 CAGGGAGGAGCATCTCCTGGAGG - Intronic
917638057 1:176956214-176956236 CAAGTAGGAGGAGAACCTGTGGG - Intronic
919493443 1:198234731-198234753 CACACAGGAGCAGCAGCAGGAGG - Intronic
920742649 1:208596058-208596080 CACGTGGGAGCAGCTCTTGATGG + Intergenic
920843835 1:209576999-209577021 CAGGGAGGAGCAGCACCTGGAGG + Intergenic
1063036198 10:2289037-2289059 CACGCAGAAGCAGCACATGTTGG + Intergenic
1064295802 10:14078256-14078278 CAAGTAGGAGAAGAACCTGGAGG + Intronic
1064380160 10:14834753-14834775 AACAAAGGAGCGGCACCTGGAGG + Intronic
1066007995 10:31165733-31165755 AAGGAAGGAGCAGCACATGGTGG + Intergenic
1068044741 10:51871754-51871776 CATGTAGGTCCAACACCTGGAGG + Intronic
1071514295 10:86286961-86286983 CTCATAGGAGCAACACCAGGTGG - Intronic
1072414248 10:95233609-95233631 CCCGTATGAGCAGCAGATGGTGG - Intergenic
1072762173 10:98065682-98065704 CACGTAGCATCAGACCCTGGGGG - Intergenic
1076181332 10:128411227-128411249 CAGGTGGGAGCAGAACCTGCAGG - Intergenic
1076403324 10:130197235-130197257 CTGGTAGGGGCATCACCTGGTGG + Intergenic
1078758668 11:14234374-14234396 CACGGAAGAGCAGGTCCTGGGGG + Intronic
1080925149 11:36748421-36748443 AAGGGAGGAGCAGCAGCTGGAGG + Intergenic
1083615070 11:64022115-64022137 CAGGCAAGAGCAGCCCCTGGGGG + Intronic
1083735003 11:64675188-64675210 CTCCTAGAAGCAGCAGCTGGAGG + Intronic
1084410277 11:69002758-69002780 CACGCAGTAGCAGGGCCTGGAGG - Intergenic
1084720344 11:70901758-70901780 CCCGGAGAAGGAGCACCTGGTGG + Intronic
1097018524 12:56004086-56004108 CACGTAGTAGGAGCACCTGGGGG + Exonic
1100192009 12:92203059-92203081 CTCTTGGGAGCAGCACCTGTAGG + Intergenic
1100350069 12:93772863-93772885 TATGTAGGAGCGGCACCTGCAGG + Intronic
1101260698 12:103026755-103026777 CTCGGAGGTGCAGCAGCTGGAGG + Intergenic
1101260852 12:103028145-103028167 CTCGGAGGTGCAGCAGCTGGAGG - Intergenic
1102554632 12:113718975-113718997 CAGGGAGGAGCAGCCCCAGGAGG - Intergenic
1104443927 12:128818530-128818552 CATGAAGCAGCCGCACCTGGAGG + Intronic
1108255127 13:48602435-48602457 CATGCATGAGAAGCACCTGGAGG - Intergenic
1108383726 13:49879212-49879234 AACGTGGGAGCAGCGCATGGAGG + Intergenic
1113758892 13:112833907-112833929 CAGGTGGGAGCAGCGGCTGGAGG - Intronic
1114473117 14:22977387-22977409 CACCTGGGAGCAGTTCCTGGGGG - Intronic
1114538053 14:23435600-23435622 CAGGTAGGAGCGGGAGCTGGAGG - Exonic
1120051505 14:79872258-79872280 CACGTGTGAGAATCACCTGGAGG + Intergenic
1121725253 14:96142785-96142807 CTGGTGGGAGCAGCAGCTGGGGG + Intergenic
1122104171 14:99439163-99439185 CTCATAGGAGCAGCTCCTGCTGG + Intronic
1123434463 15:20244946-20244968 CACGTACGCCCAGCACCAGGAGG - Intergenic
1126953739 15:53911200-53911222 CAGCTTGGAGCAGGACCTGGGGG + Intergenic
1127480274 15:59371880-59371902 CAGGTAGGGCGAGCACCTGGCGG - Intronic
1128140084 15:65293534-65293556 CAAGTAGCAGCAGGACATGGTGG + Intronic
1129250636 15:74307022-74307044 CACTAAGGAGCAGCGCCAGGAGG - Intronic
1129503522 15:76061485-76061507 CACGGAGCAGCCGCACCTGGAGG - Intronic
1130232087 15:82104814-82104836 TAGGCAGGAGCAGCAGCTGGGGG - Intergenic
1130394240 15:83488277-83488299 CACCTGGGAGCAGCGCCTGCAGG - Intronic
1131177342 15:90218322-90218344 CACTTAGGAGCAGGAGCAGGAGG - Intronic
1131653191 15:94424532-94424554 CCTGTATGAGAAGCACCTGGAGG - Intronic
1133077741 16:3292686-3292708 CAAGTATGAGCAGCACCAGTTGG - Intronic
1133229242 16:4358695-4358717 CACGTAGAAGCTGCCCATGGTGG - Intronic
1134690696 16:16189369-16189391 CAGGCAGGAGCAGCACTTGAGGG + Intronic
1136003496 16:27313600-27313622 CAGGCAGGAGCAGGTCCTGGAGG + Intergenic
1137981289 16:53072216-53072238 CCTGCAGGAGCAGCAGCTGGAGG - Intronic
1141437677 16:84009732-84009754 CACGTAGGGTCAGCCCCCGGAGG + Intronic
1141963880 16:87428007-87428029 GAGGCAGGAGCATCACCTGGAGG - Intronic
1142420121 16:89964777-89964799 CCCTTAGGAGCGGCACCTGGGGG + Intronic
1142602939 17:1065343-1065365 CACGTAACAGCAGCATCTAGAGG - Intronic
1149561080 17:57608405-57608427 CAAGTGGGAGCTGCACATGGAGG + Intronic
1150324628 17:64246862-64246884 CACGTAGACACAGCACCAGGAGG - Intronic
1152147355 17:78576479-78576501 CAAGTAGGAGGAGCACCGCGTGG + Intronic
1152423790 17:80208162-80208184 CTCAGAGGAGCAGCTCCTGGAGG + Exonic
1154298788 18:13174748-13174770 CCTGTAGGAACAGCACGTGGAGG + Intergenic
1155132195 18:22948508-22948530 CACGTAAGAGCAACACCTTCTGG - Intronic
1158737942 18:60105048-60105070 CAGGTAGCAGCATCACCTGAAGG - Intergenic
1160151589 18:76399125-76399147 CGCGTAGCACCAGCACCAGGAGG - Intronic
1160328246 18:77969439-77969461 CTCCCAGGAGCAGCTCCTGGAGG + Intergenic
1160911988 19:1478828-1478850 CACGGTGGAGCAGATCCTGGAGG - Exonic
1160918353 19:1508225-1508247 TAGGGAGGAGCAGGACCTGGCGG + Intronic
1162026987 19:7900046-7900068 CTTGGAGGAGCTGCACCTGGAGG + Exonic
1162575392 19:11496076-11496098 CCCGTACGAGCCGCACCTGGCGG - Exonic
1165030692 19:32996068-32996090 CACGTACGCCCAGCACCAGGAGG - Exonic
1165370464 19:35402477-35402499 CCTGTAGGGGCAGCAGCTGGTGG + Intergenic
1166283776 19:41811241-41811263 CACACAGGAGCAGCTCCTGGAGG - Exonic
1168627267 19:57929309-57929331 CACTGAGGAGTGGCACCTGGTGG - Intronic
926611532 2:14952902-14952924 CACGTAGGAGAAGCAACTCAGGG + Intergenic
931331113 2:61285180-61285202 CACTTAAGAGCAGCAACTGTAGG + Intronic
936091537 2:109504689-109504711 CAGGTAGGAGCAGAACCTGAAGG + Intergenic
936542221 2:113361727-113361749 CAATGAGGAGAAGCACCTGGGGG - Intergenic
938317415 2:130339766-130339788 AACTGAGGAGCAACACCTGGGGG - Intronic
943374155 2:187054686-187054708 CACTTAAGAGCAGTAGCTGGTGG + Intergenic
944090884 2:195910148-195910170 CACCTTGGAGGAGCACCTGAGGG - Exonic
947118286 2:226794785-226794807 CATGTAGGAGCAGCCACAGGAGG - Intronic
947372489 2:229462896-229462918 CAGGTAGGAGCAGCAGCTTCTGG - Intronic
948841150 2:240649691-240649713 CATGGAGGAGAAGCAGCTGGGGG - Intergenic
1169074292 20:2751874-2751896 GACGGAGGGGCAGCCCCTGGGGG - Intronic
1171237548 20:23539601-23539623 CCCGTTGGAGCAGCCCATGGAGG + Intergenic
1172036396 20:32013819-32013841 CATGTATCAGAAGCACCTGGTGG + Intronic
1174072027 20:47906053-47906075 CACCTGGGAGCAGGCCCTGGAGG - Intergenic
1174152019 20:48492616-48492638 CACCTGGGAGCAGGCCCTGGGGG + Intergenic
1175679804 20:60977629-60977651 CACGGAGGAGCAGCTCTTGAGGG + Intergenic
1176933576 21:14842033-14842055 CCTGGAGGAGGAGCACCTGGCGG - Intergenic
1179351875 21:40618853-40618875 CAGGCAGGAGCAGCGCCTGGAGG + Intronic
1179896011 21:44364138-44364160 CACGCATGAGCAGCACTTGGAGG + Exonic
1180085352 21:45505651-45505673 CACGGAGGCGCAGGAGCTGGCGG + Intronic
1182485525 22:30636499-30636521 GAAGTAGGAGCAGCAGCTGGTGG + Exonic
1182981472 22:34675385-34675407 CTAGTAGAAGCAGCAGCTGGGGG + Intergenic
1183319113 22:37154346-37154368 CACGTAGGAGGGAAACCTGGTGG + Intronic
1184746432 22:46458734-46458756 CACCCAGGTGCAGCACCAGGCGG - Intronic
1185269040 22:49919802-49919824 GGCGCAGGAGGAGCACCTGGAGG + Exonic
1185370531 22:50458953-50458975 CGCGTAGAGGCAGCACCCGGAGG + Intronic
950556016 3:13696505-13696527 CAGGTTGGAGGAGCAGCTGGTGG - Intergenic
951036563 3:17939161-17939183 CACGTAGAAGTAGAAGCTGGTGG + Intronic
952926799 3:38326367-38326389 CCTGCAGGAGCAGCACCTGTGGG + Intergenic
954660079 3:52222332-52222354 CACGGAGACGCAGCACCTGTAGG + Exonic
957497275 3:81008093-81008115 CACATACAAGCAGCACCTAGAGG - Intergenic
961511315 3:127405525-127405547 CAGATAGGAGTAGCACCAGGTGG + Intergenic
968909951 4:3472641-3472663 CAGGTTTGAGCTGCACCTGGTGG + Intronic
985947767 5:3200267-3200289 CACGGGGCAGCAGCATCTGGAGG - Intergenic
986144373 5:5063858-5063880 CAGGTAGGAGCAGCCCCTGCTGG + Intergenic
995467741 5:112467865-112467887 CACATAGGAGAAGCAACTGTAGG - Intergenic
997610207 5:135210470-135210492 CAGCTAAGAGCAGCTCCTGGTGG + Intronic
1003822763 6:9918285-9918307 CATGGAGGAGCAGCATGTGGTGG - Intronic
1005795687 6:29359630-29359652 GAAGCAGGTGCAGCACCTGGAGG + Intronic
1007038873 6:38702986-38703008 CGCGTCGGAGCAGCAACTGAGGG + Exonic
1011437366 6:87352459-87352481 CACGTAAGAGTAATACCTGGTGG - Intronic
1017679936 6:156853463-156853485 CCTGTAGGAGCAGTAGCTGGAGG + Intronic
1019258848 7:68770-68792 CACCCAGGGGCAGCACCAGGGGG - Intergenic
1023960369 7:44921591-44921613 CATCTAGGAAGAGCACCTGGGGG + Intergenic
1026792085 7:73340670-73340692 CCCTGAAGAGCAGCACCTGGTGG + Exonic
1029281606 7:99439133-99439155 CGCGGTGGAGCAGCAGCTGGGGG + Exonic
1032872301 7:135999322-135999344 TCTGTAGGAGCAGCAGCTGGAGG + Intergenic
1034219322 7:149431889-149431911 CACGCAGAAGCATCACCTGCTGG - Exonic
1034456426 7:151173452-151173474 AACGTGGGAGCAGGAGCTGGGGG - Intronic
1035290128 7:157832621-157832643 CACGAAGGAGCTGCACGTGTGGG + Intronic
1037582297 8:20252853-20252875 CATGAAGGAGCAGGACCTGCTGG - Exonic
1037828916 8:22176954-22176976 CACGTAGGAGCAGCACCTGGAGG - Exonic
1037931046 8:22880655-22880677 CAAGTAGGGAGAGCACCTGGCGG - Intronic
1039435144 8:37554868-37554890 CAAGAAGGAGCAGCACCATGGGG - Intergenic
1039752427 8:40490682-40490704 CACGTGTGAGAAGCAGCTGGAGG + Intergenic
1041171133 8:55142884-55142906 GACGAAGGAGCAGCGCCTGAAGG + Intronic
1041642451 8:60217806-60217828 GAAGTAGAAGCAGAACCTGGTGG - Intronic
1044842891 8:96352993-96353015 CACGTGGGAGCAGCACTGAGGGG + Intergenic
1049052318 8:140208409-140208431 GAAGTAGCGGCAGCACCTGGGGG + Intronic
1049321821 8:142000798-142000820 CACATCGGAGAAGCCCCTGGAGG - Intergenic
1049408430 8:142461854-142461876 CACGTGGGTTCAGCACCAGGTGG + Intronic
1052012871 9:23431769-23431791 CTCATGTGAGCAGCACCTGGGGG + Intergenic
1057943490 9:99305215-99305237 CACGTAGGTGCAGCTGCTGAAGG - Intergenic
1062064403 9:134518383-134518405 CACTAAGGAACTGCACCTGGTGG + Intergenic
1062565227 9:137161365-137161387 CACCTACGAGGTGCACCTGGTGG + Exonic
1185677611 X:1861412-1861434 CAGGGAGGAACAGCTCCTGGGGG - Intergenic
1187526421 X:20059220-20059242 CAGGTAGGAGAATCCCCTGGAGG + Intronic
1189307544 X:39998136-39998158 CAAGTAGCAGCAGTACCTCGGGG - Intergenic
1195524263 X:105868415-105868437 CATGTAGGAGGAGTACGTGGAGG - Intronic
1198214123 X:134541669-134541691 AAAATAGGAGCAGAACCTGGAGG - Intergenic
1200054896 X:153455233-153455255 AACACAGGAACAGCACCTGGAGG + Intronic